EMAIL THIS PAGE TO A FRIEND

C1orf204

chromosome 1 open reading frame 204

5 Gene Product Result for
Species: Human C1orf204(284677)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001134233 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001134233 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001134233 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001134233
C1orf204 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 204
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000338994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134233.1-450s21c1
Sequence:CCGGCCACACTGTGAAGAGCCTTGTCTCGAGACAAGGCTCTTCACAGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134233.1-498s21c1
Sequence:CCGGCCTCCACACCTTGTCCATAAACTCGAGTTTATGGACAAGGTGTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134233.1-649s21c1
Sequence:CCGGAGGTGAGTGCATGGATGAGAGCTCGAGCTCTCATCCATGCACTCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134233.1-803s21c1
Sequence:CCGGCATCCTGGAGCAATGAGTTTCCTCGAGGAAACTCATTGCTCCAGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134233.1-564s21c1
Sequence:CCGGAGAAGAATAAATGCTCCATTACTCGAGTAATGGAGCATTTATTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001134233
C1orf204 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 204
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000338994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134233.1-450s21c1
Sequence:CCGGCCACACTGTGAAGAGCCTTGTCTCGAGACAAGGCTCTTCACAGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134233.1-498s21c1
Sequence:CCGGCCTCCACACCTTGTCCATAAACTCGAGTTTATGGACAAGGTGTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134233.1-649s21c1
Sequence:CCGGAGGTGAGTGCATGGATGAGAGCTCGAGCTCTCATCCATGCACTCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134233.1-803s21c1
Sequence:CCGGCATCCTGGAGCAATGAGTTTCCTCGAGGAAACTCATTGCTCCAGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134233.1-564s21c1
Sequence:CCGGAGAAGAATAAATGCTCCATTACTCGAGTAATGGAGCATTTATTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001134233
C1orf204 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 204
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000338994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134233.1-450s21c1
Sequence:CCGGCCACACTGTGAAGAGCCTTGTCTCGAGACAAGGCTCTTCACAGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134233.1-498s21c1
Sequence:CCGGCCTCCACACCTTGTCCATAAACTCGAGTTTATGGACAAGGTGTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134233.1-649s21c1
Sequence:CCGGAGGTGAGTGCATGGATGAGAGCTCGAGCTCTCATCCATGCACTCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134233.1-803s21c1
Sequence:CCGGCATCCTGGAGCAATGAGTTTCCTCGAGGAAACTCATTGCTCCAGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134233.1-564s21c1
Sequence:CCGGAGAAGAATAAATGCTCCATTACTCGAGTAATGGAGCATTTATTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)