EMAIL THIS PAGE TO A FRIEND

C1orf43

chromosome 1 open reading frame 43

50 Gene Product Result for
Synonyms: NICE-3 NS5ATP4 S863-3
Species: Human C1orf43(25912)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015449 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015449 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015449 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU069791 MISSION® esiRNA esiRNA human C1orf43 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098616 Rosetta Predictions human pricing
NM_015449 Rosetta Predictions human pricing
NM_138740 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098616 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319496 predicted 1287
2 SASI_Hs02_00319497 predicted 1388
3 SASI_Hs02_00319498 predicted 1286
4 SASI_Hs02_00319499 predicted 1446
5 SASI_Hs02_00319500 predicted 1150
6 SASI_Hs02_00319501 predicted 1507
7 SASI_Hs02_00319502 predicted 1571
8 SASI_Hs02_00319503 predicted 1270
9 SASI_Hs02_00319504 predicted 1181
10 SASI_Hs02_00319505 predicted 1545
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015449 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194043 predicted 1193
2 SASI_Hs02_00347842 predicted 1284
3 SASI_Hs01_00194045 predicted 1185
4 SASI_Hs01_00194047 predicted 1344
5 SASI_Hs01_00194048 predicted 1052
6 SASI_Hs01_00194050 predicted 1407
7 SASI_Hs01_00194051 predicted 1471
8 SASI_Hs02_00347843 predicted 1171
9 SASI_Hs02_00347844 predicted 1082
10 SASI_Hs02_00347845 predicted 1437
11 SASI_Hs01_00194044 predicted 1274
12 SASI_Hs01_00194046 predicted 1183
13 SASI_Hs01_00194049 predicted 1113
14 SASI_Hs01_00194052 predicted 1113
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138740 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100142 predicted 1130
2 SASI_Hs02_00363865 predicted 1226
3 SASI_Hs01_00100144 predicted 1128
4 SASI_Hs01_00100146 predicted 1287
5 SASI_Hs01_00100147 predicted 994
6 SASI_Hs01_00100149 predicted 1352
7 SASI_Hs01_00100150 predicted 1418
8 SASI_Hs02_00363866 predicted 1111
9 SASI_Hs02_00363867 predicted 1028
10 SASI_Hs02_00363868 predicted 1382
11 SASI_Hs01_00100143 predicted 1231
12 SASI_Hs01_00100145 predicted 1135
13 SASI_Hs01_00100148 predicted 1066
14 SASI_Hs01_00100151 predicted 1052
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015449
VALIDATED
C1orf43 MISSION shRNA Bacterial Glycerol Stock
chromosome 1 open reading frame 43
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015449.1-439s1c1
Sequence:CCGGCGTACCTCTGAGATCCCATTTCTCGAGAAATGGGATCTCAGAGGTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165105    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015449.1-1187s1c1
Sequence:CCGGCCTTCCCTGTTCCAGGTTTATCTCGAGATAAACCTGGAACAGGGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015449.1-395s1c1
Sequence:CCGGGTTGCTACAACTATCTGTATACTCGAGTATACAGATAGTTGTAGCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015449.1-825s1c1
Sequence:CCGGGAAGAGCTTTAAGGATAACTACTCGAGTAGTTATCCTTAAAGCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015449.1-1016s1c1
Sequence:CCGGGCTTGTGTCTAAAGGGTAATTCTCGAGAATTACCCTTTAGACACAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015449.1-358s1c1
Sequence:CCGGGCTAGACTACTACAACTGGAACTCGAGTTCCAGTTGTAGTAGTCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015449.1-443s1c1
Sequence:CCGGCCTCTGAGATCCCATTTCATTCTCGAGAATGAAATGGGATCTCAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015449.1-624s1c1
Sequence:CCGGCCAGAATGAGTACCTACGCTACTCGAGTAGCGTAGGTACTCATTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015449.1-525s1c1
Sequence:CCGGGCGAAACACTAGTACGCCTTTCTCGAGAAAGGCGTACTAGTGTTTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015449
VALIDATED
C1orf43 MISSION shRNA shRNA Plasmid DNA
chromosome 1 open reading frame 43
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015449.1-439s1c1
Sequence:CCGGCGTACCTCTGAGATCCCATTTCTCGAGAAATGGGATCTCAGAGGTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165105    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015449.1-1187s1c1
Sequence:CCGGCCTTCCCTGTTCCAGGTTTATCTCGAGATAAACCTGGAACAGGGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015449.1-395s1c1
Sequence:CCGGGTTGCTACAACTATCTGTATACTCGAGTATACAGATAGTTGTAGCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015449.1-825s1c1
Sequence:CCGGGAAGAGCTTTAAGGATAACTACTCGAGTAGTTATCCTTAAAGCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015449.1-1016s1c1
Sequence:CCGGGCTTGTGTCTAAAGGGTAATTCTCGAGAATTACCCTTTAGACACAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015449.1-358s1c1
Sequence:CCGGGCTAGACTACTACAACTGGAACTCGAGTTCCAGTTGTAGTAGTCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015449.1-443s1c1
Sequence:CCGGCCTCTGAGATCCCATTTCATTCTCGAGAATGAAATGGGATCTCAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015449.1-624s1c1
Sequence:CCGGCCAGAATGAGTACCTACGCTACTCGAGTAGCGTAGGTACTCATTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015449.1-525s1c1
Sequence:CCGGGCGAAACACTAGTACGCCTTTCTCGAGAAAGGCGTACTAGTGTTTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015449
VALIDATED
C1orf43 MISSION shRNA Lentiviral Transduction Particles
chromosome 1 open reading frame 43
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015449.1-439s1c1
Sequence:CCGGCGTACCTCTGAGATCCCATTTCTCGAGAAATGGGATCTCAGAGGTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165105    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015449.1-1187s1c1
Sequence:CCGGCCTTCCCTGTTCCAGGTTTATCTCGAGATAAACCTGGAACAGGGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015449.1-395s1c1
Sequence:CCGGGTTGCTACAACTATCTGTATACTCGAGTATACAGATAGTTGTAGCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015449.1-825s1c1
Sequence:CCGGGAAGAGCTTTAAGGATAACTACTCGAGTAGTTATCCTTAAAGCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015449.1-1016s1c1
Sequence:CCGGGCTTGTGTCTAAAGGGTAATTCTCGAGAATTACCCTTTAGACACAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015449.1-358s1c1
Sequence:CCGGGCTAGACTACTACAACTGGAACTCGAGTTCCAGTTGTAGTAGTCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015449.1-443s1c1
Sequence:CCGGCCTCTGAGATCCCATTTCATTCTCGAGAATGAAATGGGATCTCAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015449.1-624s1c1
Sequence:CCGGCCAGAATGAGTACCTACGCTACTCGAGTAGCGTAGGTACTCATTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015449.1-525s1c1
Sequence:CCGGGCGAAACACTAGTACGCCTTTCTCGAGAAAGGCGTACTAGTGTTTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)