EMAIL THIS PAGE TO A FRIEND

C20orf202

chromosome 20 open reading frame 202

47 Gene Product Result for
Species: Human C20orf202(400831)
UniProtKB ID: A1L168
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001009612 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001009612 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001009612 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU104021 MISSION® esiRNA esiRNA human RP4-545L17.10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009612 Rosetta Predictions human pricing
XM_001724704 Rosetta Predictions human pricing
XM_930959 Rosetta Predictions human pricing
XM_943808 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009612 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305665 predicted 201
2 SASI_Hs02_00305666 predicted 193
3 SASI_Hs02_00305667 predicted 225
4 SASI_Hs02_00305668 predicted 169
5 SASI_Hs02_00305669 predicted 421
6 SASI_Hs02_00305670 predicted 166
7 SASI_Hs02_00305671 predicted 685
8 SASI_Hs02_00305672 predicted 637
9 SASI_Hs02_00305673 predicted 113
10 SASI_Hs02_00305674 predicted 110
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001724704 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00463187 predicted 196
2 SASI_Hs02_00463188 predicted 220
3 SASI_Hs02_00463189 predicted 228
4 SASI_Hs02_00463190 predicted 160
5 SASI_Hs02_00463191 predicted 411
6 SASI_Hs02_00463192 predicted 160
7 SASI_Hs02_00463193 predicted 682
8 SASI_Hs02_00463194 predicted 633
9 SASI_Hs02_00463195 predicted 109
10 SASI_Hs02_00463196 predicted 107
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930959 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00260936 predicted 159
2 SASI_Hs01_00260937 predicted 419
3 SASI_Hs01_00260938 predicted 155
4 SASI_Hs01_00260939 predicted 679
5 SASI_Hs01_00260940 predicted 633
6 SASI_Hs01_00260941 predicted 109
7 SASI_Hs01_00260942 predicted 104
8 SASI_Hs01_00260943 predicted 425
9 SASI_Hs01_00260944 predicted 395
10 SASI_Hs01_00260945 predicted 423
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_943808 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00486145 predicted 201
2 SASI_Hs02_00486146 predicted 219
3 SASI_Hs02_00486147 predicted 157
4 SASI_Hs02_00486148 predicted 418
5 SASI_Hs02_00486149 predicted 156
6 SASI_Hs02_00486150 predicted 676
7 SASI_Hs02_00486151 predicted 627
8 SASI_Hs02_00486152 predicted 106
9 SASI_Hs02_00486153 predicted 100
10 SASI_Hs02_00486154 predicted 429
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001009612
C20orf202 MISSION shRNA Bacterial Glycerol Stock
chromosome 20 open reading frame 202
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009612.2-103s21c1
Sequence:CCGGAGTGTCAAGGTCACTCCTAAGCTCGAGCTTAGGAGTGACCTTGACACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001009612.2-724s21c1
Sequence:CCGGTAACCCTATCCTTGGGAATTTCTCGAGAAATTCCCAAGGATAGGGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001009612.2-636s21c1
Sequence:CCGGGTGAGGCACACATAAGGTATTCTCGAGAATACCTTATGTGTGCCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421025    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001009612.2-477s21c1
Sequence:CCGGTAACCTTTCACTGTGATATTTCTCGAGAAATATCACAGTGAAAGGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009612.2-426s21c1
Sequence:CCGGCCCTTAACTGGACGGAGATGACTCGAGTCATCTCCGTCCAGTTAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009612.1-374s1c1
Sequence:CCGGGATTCAAGATCAGAGTCTCCTCTCGAGAGGAGACTCTGATCTTGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143277    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009612.1-1523s1c1
Sequence:CCGGGCTAGAATGGTCTTGAGGAATCTCGAGATTCCTCAAGACCATTCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009612.1-350s1c1
Sequence:CCGGGAGAAAGGAGCTGTCTGAGATCTCGAGATCTCAGACAGCTCCTTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142348    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009612.1-357s1c1
Sequence:CCGGGAGCTGTCTGAGATGCAGATTCTCGAGAATCTGCATCTCAGACAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009612.1-1153s1c1
Sequence:CCGGCCCAATGGATGGTCATGTGAACTCGAGTTCACATGACCATCCATTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009612.1-1255s1c1
Sequence:CCGGGCCATGTTCCTACCAGGTAAACTCGAGTTTACCTGGTAGGAACATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143456    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009612.1-1082s1c1
Sequence:CCGGGCCATAGGCATGGGTATATTACTCGAGTAATATACCCATGCCTATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143427    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009612.1-1303s1c1
Sequence:CCGGGAGGCTAATCTCCAAAGAGAACTCGAGTTCTCTTTGGAGATTAGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001009612
C20orf202 MISSION shRNA shRNA Plasmid DNA
chromosome 20 open reading frame 202
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009612.2-103s21c1
Sequence:CCGGAGTGTCAAGGTCACTCCTAAGCTCGAGCTTAGGAGTGACCTTGACACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001009612.2-724s21c1
Sequence:CCGGTAACCCTATCCTTGGGAATTTCTCGAGAAATTCCCAAGGATAGGGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001009612.2-636s21c1
Sequence:CCGGGTGAGGCACACATAAGGTATTCTCGAGAATACCTTATGTGTGCCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421025    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001009612.2-477s21c1
Sequence:CCGGTAACCTTTCACTGTGATATTTCTCGAGAAATATCACAGTGAAAGGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009612.2-426s21c1
Sequence:CCGGCCCTTAACTGGACGGAGATGACTCGAGTCATCTCCGTCCAGTTAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009612.1-374s1c1
Sequence:CCGGGATTCAAGATCAGAGTCTCCTCTCGAGAGGAGACTCTGATCTTGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143277    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009612.1-1523s1c1
Sequence:CCGGGCTAGAATGGTCTTGAGGAATCTCGAGATTCCTCAAGACCATTCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009612.1-350s1c1
Sequence:CCGGGAGAAAGGAGCTGTCTGAGATCTCGAGATCTCAGACAGCTCCTTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142348    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009612.1-357s1c1
Sequence:CCGGGAGCTGTCTGAGATGCAGATTCTCGAGAATCTGCATCTCAGACAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009612.1-1153s1c1
Sequence:CCGGCCCAATGGATGGTCATGTGAACTCGAGTTCACATGACCATCCATTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009612.1-1255s1c1
Sequence:CCGGGCCATGTTCCTACCAGGTAAACTCGAGTTTACCTGGTAGGAACATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143456    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009612.1-1082s1c1
Sequence:CCGGGCCATAGGCATGGGTATATTACTCGAGTAATATACCCATGCCTATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143427    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009612.1-1303s1c1
Sequence:CCGGGAGGCTAATCTCCAAAGAGAACTCGAGTTCTCTTTGGAGATTAGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001009612
C20orf202 MISSION shRNA Lentiviral Transduction Particles
chromosome 20 open reading frame 202
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009612.2-103s21c1
Sequence:CCGGAGTGTCAAGGTCACTCCTAAGCTCGAGCTTAGGAGTGACCTTGACACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001009612.2-724s21c1
Sequence:CCGGTAACCCTATCCTTGGGAATTTCTCGAGAAATTCCCAAGGATAGGGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001009612.2-636s21c1
Sequence:CCGGGTGAGGCACACATAAGGTATTCTCGAGAATACCTTATGTGTGCCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421025    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001009612.2-477s21c1
Sequence:CCGGTAACCTTTCACTGTGATATTTCTCGAGAAATATCACAGTGAAAGGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001009612.2-426s21c1
Sequence:CCGGCCCTTAACTGGACGGAGATGACTCGAGTCATCTCCGTCCAGTTAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009612.1-374s1c1
Sequence:CCGGGATTCAAGATCAGAGTCTCCTCTCGAGAGGAGACTCTGATCTTGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143277    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009612.1-1523s1c1
Sequence:CCGGGCTAGAATGGTCTTGAGGAATCTCGAGATTCCTCAAGACCATTCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009612.1-350s1c1
Sequence:CCGGGAGAAAGGAGCTGTCTGAGATCTCGAGATCTCAGACAGCTCCTTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142348    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009612.1-357s1c1
Sequence:CCGGGAGCTGTCTGAGATGCAGATTCTCGAGAATCTGCATCTCAGACAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009612.1-1153s1c1
Sequence:CCGGCCCAATGGATGGTCATGTGAACTCGAGTTCACATGACCATCCATTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009612.1-1255s1c1
Sequence:CCGGGCCATGTTCCTACCAGGTAAACTCGAGTTTACCTGGTAGGAACATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143456    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009612.1-1082s1c1
Sequence:CCGGGCCATAGGCATGGGTATATTACTCGAGTAATATACCCATGCCTATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143427    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009612.1-1303s1c1
Sequence:CCGGGAGGCTAATCTCCAAAGAGAACTCGAGTTCTCTTTGGAGATTAGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)