EMAIL THIS PAGE TO A FRIEND

C2CD2

C2 calcium-dependent domain containing 2

73 Gene Product Result for
Synonyms: C21orf25 C21orf258 TMEM24L
UniProtKB ID: Q9Y426, Q5R2V7, Q6AHX8, Q9NSE6
Gene ID:
Mouse(207781) C2 calcium-dependent domain containing 2
Rat(304055) C2 calcium-dependent domain containing 2
chicken(418532) C2 calcium-dependent domain containing 2
cow(529537) C2 calcium-dependent domain containing 2
Horse(100058281) C2 calcium-dependent domain containing 2
domestic cat(101094781) C2 calcium-dependent domain containing 2
dog(487774) C2 calcium-dependent domain containing 2
sheep(101120722) C2 calcium-dependent domain containing 2
Domestic Rabbit(100356008) C2 calcium-dependent domain containing 2
naked mole-rat(101712330) C2 calcium-dependent domain containing 2
domestic guinea pig(100721400) C2 calcium-dependent domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174847 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_174847 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_174847 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_199050 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199050 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199050 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015500 Rosetta Predictions human pricing
NM_199050 Rosetta Predictions human pricing
XM_032945 Rosetta Predictions human pricing
NM_199391 Rosetta Predictions rat pricing
NM_174847 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015500 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347974 predicted 1211
2 SASI_Hs02_00347975 predicted 960
3 SASI_Hs02_00347976 predicted 1184
4 SASI_Hs02_00347977 predicted 1715
5 SASI_Hs02_00347978 predicted 1664
6 SASI_Hs02_00347979 predicted 1749
7 SASI_Hs02_00347980 predicted 2185
8 SASI_Hs02_00347981 predicted 1577
9 SASI_Hs02_00347982 predicted 971
10 SASI_Hs02_00347983 predicted 2098
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199050 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218802 predicted 711
2 SASI_Hs01_00218803 predicted 461
3 SASI_Hs01_00218804 predicted 679
4 SASI_Hs01_00218805 predicted 1215
5 SASI_Hs01_00218806 predicted 1165
6 SASI_Hs01_00218807 predicted 1250
7 SASI_Hs01_00218808 predicted 1680
8 SASI_Hs01_00218809 predicted 1077
9 SASI_Hs01_00218810 predicted 475
10 SASI_Hs01_00218811 predicted 1598
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_032945 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00478639 predicted 712
2 SASI_Hs02_00478640 predicted 455
3 SASI_Hs02_00478641 predicted 675
4 SASI_Hs02_00478642 predicted 1215
5 SASI_Hs02_00478643 predicted 1169
6 SASI_Hs02_00478644 predicted 1248
7 SASI_Hs02_00478645 predicted 1680
8 SASI_Hs02_00478646 predicted 1070
9 SASI_Hs02_00478647 predicted 471
10 SASI_Hs02_00478648 predicted 1595
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199391 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038050 predicted 871
2 SASI_Rn01_00038051 predicted 1030
3 SASI_Rn01_00038052 predicted 1555
4 SASI_Rn01_00038053 predicted 394
5 SASI_Rn02_00270214 predicted 826
6 SASI_Rn01_00038054 predicted 2096
7 SASI_Rn01_00038055 predicted 925
8 SASI_Rn01_00038057 predicted 1276
9 SASI_Rn01_00038058 predicted 1102
10 SASI_Rn01_00038059 predicted 1496
11 SASI_Rn01_00038056 predicted 1165
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174847 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145076 predicted 2122
2 SASI_Mm01_00145077 predicted 2222
3 SASI_Mm01_00145078 predicted 791
4 SASI_Mm01_00145079 predicted 879
5 SASI_Mm01_00145081 predicted 1308
6 SASI_Mm01_00145082 predicted 776
7 SASI_Mm02_00345494 predicted 1449
8 SASI_Mm01_00145083 predicted 1742
9 SASI_Mm01_00145084 predicted 1790
10 SASI_Mm01_00145085 predicted 2230
11 SASI_Mm01_00145080 predicted 1306
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174847
C2CD2 MISSION shRNA Bacterial Glycerol Stock
C2 calcium-dependent domain containing 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174847.1-2220s1c1
Sequence:CCGGCCAGTCACATAATGACCTGGTCTCGAGACCAGGTCATTATGTGACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179284    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174847.1-2459s1c1
Sequence:CCGGGCTTGTCTATCTTGGTTGTTTCTCGAGAAACAACCAAGATAGACAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174847.1-2129s21c1
Sequence:CCGGGAGCTATGAAGAAGCATAAAGCTCGAGCTTTATGCTTCTTCATAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174847.1-2224s21c1
Sequence:CCGGTCACATAATGACCTGGTATTCCTCGAGGAATACCAGGTCATTATGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174847.1-1301s21c1
Sequence:CCGGCCATTCACCTGGACCTATTTACTCGAGTAAATAGGTCCAGGTGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174847.1-1601s21c1
Sequence:CCGGCCGTCACAGTGAAGGTCATTGCTCGAGCAATGACCTTCACTGTGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174847.1-2563s21c1
Sequence:CCGGGTCCAGTTTGCTACCAGATACCTCGAGGTATCTGGTAGCAAACTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174847
C2CD2 MISSION shRNA shRNA Plasmid DNA
C2 calcium-dependent domain containing 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174847.1-2220s1c1
Sequence:CCGGCCAGTCACATAATGACCTGGTCTCGAGACCAGGTCATTATGTGACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179284    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174847.1-2459s1c1
Sequence:CCGGGCTTGTCTATCTTGGTTGTTTCTCGAGAAACAACCAAGATAGACAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174847.1-2129s21c1
Sequence:CCGGGAGCTATGAAGAAGCATAAAGCTCGAGCTTTATGCTTCTTCATAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174847.1-2224s21c1
Sequence:CCGGTCACATAATGACCTGGTATTCCTCGAGGAATACCAGGTCATTATGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174847.1-1301s21c1
Sequence:CCGGCCATTCACCTGGACCTATTTACTCGAGTAAATAGGTCCAGGTGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174847.1-1601s21c1
Sequence:CCGGCCGTCACAGTGAAGGTCATTGCTCGAGCAATGACCTTCACTGTGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174847.1-2563s21c1
Sequence:CCGGGTCCAGTTTGCTACCAGATACCTCGAGGTATCTGGTAGCAAACTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174847
C2CD2 MISSION shRNA Lentiviral Transduction Particles
C2 calcium-dependent domain containing 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174847.1-2220s1c1
Sequence:CCGGCCAGTCACATAATGACCTGGTCTCGAGACCAGGTCATTATGTGACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179284    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174847.1-2459s1c1
Sequence:CCGGGCTTGTCTATCTTGGTTGTTTCTCGAGAAACAACCAAGATAGACAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174847.1-2129s21c1
Sequence:CCGGGAGCTATGAAGAAGCATAAAGCTCGAGCTTTATGCTTCTTCATAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174847.1-2224s21c1
Sequence:CCGGTCACATAATGACCTGGTATTCCTCGAGGAATACCAGGTCATTATGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174847.1-1301s21c1
Sequence:CCGGCCATTCACCTGGACCTATTTACTCGAGTAAATAGGTCCAGGTGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174847.1-1601s21c1
Sequence:CCGGCCGTCACAGTGAAGGTCATTGCTCGAGCAATGACCTTCACTGTGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174847.1-2563s21c1
Sequence:CCGGGTCCAGTTTGCTACCAGATACCTCGAGGTATCTGGTAGCAAACTGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199050
VALIDATED
C2CD2 MISSION shRNA Bacterial Glycerol Stock
C2 calcium-dependent domain containing 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137475    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199050.1-692s1c1
Sequence:CCGGGAAGGAGTTACACCTGCAGATCTCGAGATCTGCAGGTGTAACTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_199050.1-1195s1c1
Sequence:CCGGCCATTCGACAGCTCAGTGAATCTCGAGATTCACTGAGCTGTCGAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199050.1-674s1c1
Sequence:CCGGCGAGTTGAATGCCAAGTCGAACTCGAGTTCGACTTGGCATTCAACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_199050.1-1208s1c1
Sequence:CCGGCAGTGAATCTTCAAAGCTGAACTCGAGTTCAGCTTTGAAGATTCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_199050.1-426s1c1
Sequence:CCGGGTAAAGGAAGCTCAGAACTTACTCGAGTAAGTTCTGAGCTTCCTTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_199050.1-262s1c1
Sequence:CCGGCTTTCATCAGTGTGCCGGAAACTCGAGTTTCCGGCACACTGATGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199050
VALIDATED
C2CD2 MISSION shRNA shRNA Plasmid DNA
C2 calcium-dependent domain containing 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137475    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199050.1-692s1c1
Sequence:CCGGGAAGGAGTTACACCTGCAGATCTCGAGATCTGCAGGTGTAACTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_199050.1-1195s1c1
Sequence:CCGGCCATTCGACAGCTCAGTGAATCTCGAGATTCACTGAGCTGTCGAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199050.1-674s1c1
Sequence:CCGGCGAGTTGAATGCCAAGTCGAACTCGAGTTCGACTTGGCATTCAACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_199050.1-1208s1c1
Sequence:CCGGCAGTGAATCTTCAAAGCTGAACTCGAGTTCAGCTTTGAAGATTCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_199050.1-426s1c1
Sequence:CCGGGTAAAGGAAGCTCAGAACTTACTCGAGTAAGTTCTGAGCTTCCTTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_199050.1-262s1c1
Sequence:CCGGCTTTCATCAGTGTGCCGGAAACTCGAGTTTCCGGCACACTGATGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199050
VALIDATED
C2CD2 MISSION shRNA Lentiviral Transduction Particles
C2 calcium-dependent domain containing 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137475    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199050.1-692s1c1
Sequence:CCGGGAAGGAGTTACACCTGCAGATCTCGAGATCTGCAGGTGTAACTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_199050.1-1195s1c1
Sequence:CCGGCCATTCGACAGCTCAGTGAATCTCGAGATTCACTGAGCTGTCGAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199050.1-674s1c1
Sequence:CCGGCGAGTTGAATGCCAAGTCGAACTCGAGTTCGACTTGGCATTCAACTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_199050.1-1208s1c1
Sequence:CCGGCAGTGAATCTTCAAAGCTGAACTCGAGTTCAGCTTTGAAGATTCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_199050.1-426s1c1
Sequence:CCGGGTAAAGGAAGCTCAGAACTTACTCGAGTAAGTTCTGAGCTTCCTTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_199050.1-262s1c1
Sequence:CCGGCTTTCATCAGTGTGCCGGAAACTCGAGTTTCCGGCACACTGATGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)