EMAIL THIS PAGE TO A FRIEND

C2orf88

chromosome 2 open reading frame 88

168 Gene Product Result for
Synonyms: smAKAP
Species: Human C2orf88(84281)
UniProtKB ID: Q9BSF0, D3DPI3, Q53TC7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032321 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032321 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032321 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042519 Rosetta Predictions human pricing
NM_001042520 Rosetta Predictions human pricing
NM_001042521 Rosetta Predictions human pricing
NM_032321 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042519 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310308 predicted 806
2 SASI_Hs02_00310309 predicted 663
3 SASI_Hs02_00310310 predicted 641
4 SASI_Hs02_00310311 predicted 932
5 SASI_Hs02_00310312 predicted 632
6 SASI_Hs02_00310313 predicted 780
7 SASI_Hs02_00310314 predicted 828
8 SASI_Hs02_00310315 predicted 642
9 SASI_Hs02_00310316 predicted 656
10 SASI_Hs02_00310317 predicted 1139
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042520 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310318 predicted 764
2 SASI_Hs02_00310319 predicted 616
3 SASI_Hs02_00310320 predicted 592
4 SASI_Hs02_00310321 predicted 888
5 SASI_Hs02_00310322 predicted 584
6 SASI_Hs02_00310323 predicted 733
7 SASI_Hs02_00310324 predicted 792
8 SASI_Hs02_00310325 predicted 600
9 SASI_Hs02_00310326 predicted 607
10 SASI_Hs02_00310327 predicted 1101
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042521 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310328 predicted 775
2 SASI_Hs02_00310329 predicted 629
3 SASI_Hs02_00310330 predicted 606
4 SASI_Hs02_00310331 predicted 907
5 SASI_Hs02_00310332 predicted 593
6 SASI_Hs02_00310333 predicted 740
7 SASI_Hs02_00310334 predicted 795
8 SASI_Hs02_00310335 predicted 611
9 SASI_Hs02_00310336 predicted 622
10 SASI_Hs02_00310337 predicted 1105
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032321 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359676 predicted 731
2 SASI_Hs02_00359677 predicted 587
3 SASI_Hs02_00359678 predicted 565
4 SASI_Hs02_00359679 predicted 864
5 SASI_Hs02_00359680 predicted 551
6 SASI_Hs02_00359681 predicted 701
7 SASI_Hs02_00359682 predicted 754
8 SASI_Hs02_00359683 predicted 569
9 SASI_Hs02_00359684 predicted 582
10 SASI_Hs02_00359685 predicted 1072
11 SASI_Hs01_00030389 predicted 445
12 SASI_Hs01_00030390 predicted 459
13 SASI_Hs01_00030391 predicted 449
14 SASI_Hs01_00030392 predicted 349
15 SASI_Hs01_00030393 predicted 367
16 SASI_Hs01_00030394 predicted 449
17 SASI_Hs01_00030395 predicted 400
18 SASI_Hs01_00030396 predicted 445
19 SASI_Hs01_00030397 predicted 427
20 SASI_Hs01_00030398 predicted 406
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032321
C2orf88 MISSION shRNA Bacterial Glycerol Stock
chromosome 2 open reading frame 88
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032321.1-401s1c1
Sequence:CCGGGCATGAGAGTGAAGAACCCTTCTCGAGAAGGGTTCTTCACTCTCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032321.1-468s1c1
Sequence:CCGGGTCAAAGAGGAAGTGAAGGAACTCGAGTTCCTTCACTTCCTCTTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032321.1-540s1c1
Sequence:CCGGGATATCTTGTGTGATGCCTTGCTCGAGCAAGGCATCACACAAGATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032321.1-453s1c1
Sequence:CCGGGCTTCTCCAGTTAATGTCAAACTCGAGTTTGACATTAACTGGAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032321.1-533s1c1
Sequence:CCGGGTCTCAGGATATCTTGTGTGACTCGAGTCACACAAGATATCCTGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032321.1-405s1c1
Sequence:CCGGGAGAGTGAAGAACCCTTTATGCTCGAGCATAAAGGGTTCTTCACTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032321.1-493s1c1
Sequence:CCGGCAGGGACCAATATTGTGATCTCTCGAGAGATCACAATATTGGTCCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032321.1-411s1c1
Sequence:CCGGGAAGAACCCTTTATGCCAGAACTCGAGTTCTGGCATAAAGGGTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032321.1-418s1c1
Sequence:CCGGCCTTTATGCCAGAAGAGAGATCTCGAGATCTCTCTTCTGGCATAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032321.1-417s1c1
Sequence:CCGGCCCTTTATGCCAGAAGAGAGACTCGAGTCTCTCTTCTGGCATAAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032321
C2orf88 MISSION shRNA shRNA Plasmid DNA
chromosome 2 open reading frame 88
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032321.1-401s1c1
Sequence:CCGGGCATGAGAGTGAAGAACCCTTCTCGAGAAGGGTTCTTCACTCTCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032321.1-468s1c1
Sequence:CCGGGTCAAAGAGGAAGTGAAGGAACTCGAGTTCCTTCACTTCCTCTTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032321.1-540s1c1
Sequence:CCGGGATATCTTGTGTGATGCCTTGCTCGAGCAAGGCATCACACAAGATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032321.1-453s1c1
Sequence:CCGGGCTTCTCCAGTTAATGTCAAACTCGAGTTTGACATTAACTGGAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032321.1-533s1c1
Sequence:CCGGGTCTCAGGATATCTTGTGTGACTCGAGTCACACAAGATATCCTGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032321.1-405s1c1
Sequence:CCGGGAGAGTGAAGAACCCTTTATGCTCGAGCATAAAGGGTTCTTCACTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032321.1-493s1c1
Sequence:CCGGCAGGGACCAATATTGTGATCTCTCGAGAGATCACAATATTGGTCCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032321.1-411s1c1
Sequence:CCGGGAAGAACCCTTTATGCCAGAACTCGAGTTCTGGCATAAAGGGTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032321.1-418s1c1
Sequence:CCGGCCTTTATGCCAGAAGAGAGATCTCGAGATCTCTCTTCTGGCATAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032321.1-417s1c1
Sequence:CCGGCCCTTTATGCCAGAAGAGAGACTCGAGTCTCTCTTCTGGCATAAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032321
C2orf88 MISSION shRNA Lentiviral Transduction Particles
chromosome 2 open reading frame 88
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032321.1-401s1c1
Sequence:CCGGGCATGAGAGTGAAGAACCCTTCTCGAGAAGGGTTCTTCACTCTCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032321.1-468s1c1
Sequence:CCGGGTCAAAGAGGAAGTGAAGGAACTCGAGTTCCTTCACTTCCTCTTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032321.1-540s1c1
Sequence:CCGGGATATCTTGTGTGATGCCTTGCTCGAGCAAGGCATCACACAAGATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032321.1-453s1c1
Sequence:CCGGGCTTCTCCAGTTAATGTCAAACTCGAGTTTGACATTAACTGGAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032321.1-533s1c1
Sequence:CCGGGTCTCAGGATATCTTGTGTGACTCGAGTCACACAAGATATCCTGAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032321.1-405s1c1
Sequence:CCGGGAGAGTGAAGAACCCTTTATGCTCGAGCATAAAGGGTTCTTCACTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032321.1-493s1c1
Sequence:CCGGCAGGGACCAATATTGTGATCTCTCGAGAGATCACAATATTGGTCCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032321.1-411s1c1
Sequence:CCGGGAAGAACCCTTTATGCCAGAACTCGAGTTCTGGCATAAAGGGTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032321.1-418s1c1
Sequence:CCGGCCTTTATGCCAGAAGAGAGATCTCGAGATCTCTCTTCTGGCATAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032321.1-417s1c1
Sequence:CCGGCCCTTTATGCCAGAAGAGAGACTCGAGTCTCTCTTCTGGCATAAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)