EMAIL THIS PAGE TO A FRIEND

C330018D20Rik

23 Gene Product Result for
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029909 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029909 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029909 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU203661 MISSION® esiRNA targeting mouse C330018d20rik mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_894494 Rosetta Predictions mouse pricing
XM_914864 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_894494 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00279786 predicted 488
2 SASI_Mm01_00279787 predicted 495
3 SASI_Mm01_00279788 predicted 388
4 SASI_Mm01_00279789 predicted 805
5 SASI_Mm01_00279790 predicted 642
6 SASI_Mm02_00429505 predicted 282
7 SASI_Mm01_00279792 predicted 436
8 SASI_Mm01_00279793 predicted 448
9 SASI_Mm01_00279794 predicted 612
10 SASI_Mm02_00429506 predicted 505
11 SASI_Mm01_00279785 predicted 241
12 SASI_Mm01_00279791 predicted 539
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_914864 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00438967 predicted 482
2 SASI_Mm02_00438968 predicted 493
3 SASI_Mm02_00438969 predicted 388
4 SASI_Mm02_00438970 predicted 800
5 SASI_Mm02_00438971 predicted 642
6 SASI_Mm02_00438972 predicted 279
7 SASI_Mm02_00438973 predicted 440
8 SASI_Mm02_00438974 predicted 446
9 SASI_Mm02_00438975 predicted 613
10 SASI_Mm02_00438976 predicted 507
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029909
VALIDATED
C330018D20Rik MISSION shRNA Bacterial Glycerol Stock
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029909.1-422s21c1
Sequence:CCGGCTGATGATGCATCGAGTAAATCTCGAGATTTACTCGATGCATCATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029909.1-296s21c1
Sequence:CCGGGAAGTTCTCCAGCCGTATAAACTCGAGTTTATACGGCTGGAGAACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029909.1-365s21c1
Sequence:CCGGACTTGGTATGAACGGTATAAACTCGAGTTTATACCGTTCATACCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367198    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029909.1-719s21c1
Sequence:CCGGGCCTAACTTTAGCGGAGTAAACTCGAGTTTACTCCGCTAAAGTTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029909.1-487s21c1
Sequence:CCGGGCTGGCTACAAACTGATATTTCTCGAGAAATATCAGTTTGTAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029909
VALIDATED
C330018D20Rik MISSION shRNA shRNA Plasmid DNA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029909.1-422s21c1
Sequence:CCGGCTGATGATGCATCGAGTAAATCTCGAGATTTACTCGATGCATCATCAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000367199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029909.1-296s21c1
Sequence:CCGGGAAGTTCTCCAGCCGTATAAACTCGAGTTTATACGGCTGGAGAACTTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000367196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029909.1-365s21c1
Sequence:CCGGACTTGGTATGAACGGTATAAACTCGAGTTTATACCGTTCATACCAAGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000367198    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029909.1-719s21c1
Sequence:CCGGGCCTAACTTTAGCGGAGTAAACTCGAGTTTACTCCGCTAAAGTTAGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000367197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029909.1-487s21c1
Sequence:CCGGGCTGGCTACAAACTGATATTTCTCGAGAAATATCAGTTTGTAGCCAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029909
VALIDATED
C330018D20Rik MISSION shRNA Lentiviral Transduction Particles
Mouse
5 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000377188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029909.1-422s21c1
Sequence:CCGGCTGATGATGCATCGAGTAAATCTCGAGATTTACTCGATGCATCATCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029909.1-296s21c1
Sequence:CCGGGAAGTTCTCCAGCCGTATAAACTCGAGTTTATACGGCTGGAGAACTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029909.1-365s21c1
Sequence:CCGGACTTGGTATGAACGGTATAAACTCGAGTTTATACCGTTCATACCAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367198    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029909.1-719s21c1
Sequence:CCGGGCCTAACTTTAGCGGAGTAAACTCGAGTTTACTCCGCTAAAGTTAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029909.1-487s21c1
Sequence:CCGGGCTGGCTACAAACTGATATTTCTCGAGAAATATCAGTTTGTAGCCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)