EMAIL THIS PAGE TO A FRIEND

C3orf22

chromosome 3 open reading frame 22

18 Gene Product Result for
Species: Human C3orf22(152065)
UniProtKB ID: Q8N5N4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152533 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152533 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152533 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU154041 MISSION® esiRNA esiRNA human C3orf22 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152533 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152533 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202017 predicted 619
2 SASI_Hs01_00202018 predicted 412
3 SASI_Hs01_00202019 predicted 329
4 SASI_Hs01_00202020 predicted 463
5 SASI_Hs01_00202021 predicted 340
6 SASI_Hs01_00202022 predicted 614
7 SASI_Hs01_00202023 predicted 617
8 SASI_Hs01_00202024 predicted 606
9 SASI_Hs01_00202025 predicted 710
10 SASI_Hs01_00202026 predicted 389
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152533
C3orf22 MISSION shRNA Bacterial Glycerol Stock
chromosome 3 open reading frame 22
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000447393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152533.1-467s21c1
Sequence:CCGCGGTCACAAACGACTCGAACACCTCGAGGTGTTCGAGTCGTTTGTGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152533.1-779s21c1
Sequence:CCGGTCTTATTGGCCACCTTCTCCTCTCGAGAGGAGAAGGTGGCCAATAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152533.1-502s21c1
Sequence:CCGGTGCAGAAGAGGTTGGTGCCAACTCGAGTTGGCACCAACCTCTTCTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152533.1-626s1c1
Sequence:CCGGCCTTTGGGAACTCAAGTTGCTCTCGAGAGCAACTTGAGTTCCCAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166789    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152533.1-360s1c1
Sequence:CCGGCAGAGTAAGAAGTGGAGGATCCTCGAGGATCCTCCACTTCTTACTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163053    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152533.1-816s1c1
Sequence:CCGGGTAGCCACAGAGACTTTAGTACTCGAGTACTAAAGTCTCTGTGGCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152533.1-401s1c1
Sequence:CCGGCAAGAAGTTTCCGTACAGGTTCTCGAGAACCTGTACGGAAACTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152533.1-359s1c1
Sequence:CCGGCCAGAGTAAGAAGTGGAGGATCTCGAGATCCTCCACTTCTTACTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152533.1-362s1c1
Sequence:CCGGGAGTAAGAAGTGGAGGATCCACTCGAGTGGATCCTCCACTTCTTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166553    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152533.1-764s1c1
Sequence:CCGGCTCTGTGTGTGGCCTTCTTATCTCGAGATAAGAAGGCCACACACAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152533
C3orf22 MISSION shRNA shRNA Plasmid DNA
chromosome 3 open reading frame 22
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000447393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152533.1-467s21c1
Sequence:CCGCGGTCACAAACGACTCGAACACCTCGAGGTGTTCGAGTCGTTTGTGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152533.1-779s21c1
Sequence:CCGGTCTTATTGGCCACCTTCTCCTCTCGAGAGGAGAAGGTGGCCAATAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000442030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152533.1-502s21c1
Sequence:CCGGTGCAGAAGAGGTTGGTGCCAACTCGAGTTGGCACCAACCTCTTCTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152533.1-626s1c1
Sequence:CCGGCCTTTGGGAACTCAAGTTGCTCTCGAGAGCAACTTGAGTTCCCAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166789    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152533.1-360s1c1
Sequence:CCGGCAGAGTAAGAAGTGGAGGATCCTCGAGGATCCTCCACTTCTTACTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163053    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152533.1-816s1c1
Sequence:CCGGGTAGCCACAGAGACTTTAGTACTCGAGTACTAAAGTCTCTGTGGCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152533.1-401s1c1
Sequence:CCGGCAAGAAGTTTCCGTACAGGTTCTCGAGAACCTGTACGGAAACTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152533.1-359s1c1
Sequence:CCGGCCAGAGTAAGAAGTGGAGGATCTCGAGATCCTCCACTTCTTACTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152533.1-362s1c1
Sequence:CCGGGAGTAAGAAGTGGAGGATCCACTCGAGTGGATCCTCCACTTCTTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166553    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152533.1-764s1c1
Sequence:CCGGCTCTGTGTGTGGCCTTCTTATCTCGAGATAAGAAGGCCACACACAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152533
C3orf22 MISSION shRNA Lentiviral Transduction Particles
chromosome 3 open reading frame 22
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000447393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152533.1-467s21c1
Sequence:CCGCGGTCACAAACGACTCGAACACCTCGAGGTGTTCGAGTCGTTTGTGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152533.1-779s21c1
Sequence:CCGGTCTTATTGGCCACCTTCTCCTCTCGAGAGGAGAAGGTGGCCAATAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152533.1-502s21c1
Sequence:CCGGTGCAGAAGAGGTTGGTGCCAACTCGAGTTGGCACCAACCTCTTCTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152533.1-626s1c1
Sequence:CCGGCCTTTGGGAACTCAAGTTGCTCTCGAGAGCAACTTGAGTTCCCAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166789    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152533.1-360s1c1
Sequence:CCGGCAGAGTAAGAAGTGGAGGATCCTCGAGGATCCTCCACTTCTTACTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163053    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152533.1-816s1c1
Sequence:CCGGGTAGCCACAGAGACTTTAGTACTCGAGTACTAAAGTCTCTGTGGCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152533.1-401s1c1
Sequence:CCGGCAAGAAGTTTCCGTACAGGTTCTCGAGAACCTGTACGGAAACTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152533.1-359s1c1
Sequence:CCGGCCAGAGTAAGAAGTGGAGGATCTCGAGATCCTCCACTTCTTACTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152533.1-362s1c1
Sequence:CCGGGAGTAAGAAGTGGAGGATCCACTCGAGTGGATCCTCCACTTCTTACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166553    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152533.1-764s1c1
Sequence:CCGGCTCTGTGTGTGGCCTTCTTATCTCGAGATAAGAAGGCCACACACAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)