EMAIL THIS PAGE TO A FRIEND

C4orf22

chromosome 4 open reading frame 22

23 Gene Product Result for
Species: Human C4orf22(255119)
UniProtKB ID: Q6V702, E7EQ13, Q6ZQY4, Q8N4G9
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152770 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152770 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152770 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU002921 MISSION® esiRNA esiRNA targeting human C4orf22 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152770 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152770 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010343 predicted 194
2 SASI_Hs01_00010345 predicted 196
3 SASI_Hs01_00010346 predicted 240
4 SASI_Hs01_00010347 predicted 241
5 SASI_Hs01_00010348 predicted 259
6 SASI_Hs01_00010349 predicted 249
7 SASI_Hs01_00010350 predicted 233
8 SASI_Hs01_00010351 predicted 244
9 SASI_Hs01_00010352 predicted 197
10 SASI_Hs02_00366710 predicted 203
11 SASI_Hs01_00010344 predicted 275
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152770
C4orf22 MISSION shRNA Bacterial Glycerol Stock
chromosome 4 open reading frame 22
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152770.1-143s1c1
Sequence:CCGGGACTTGTACTACCTGGAGGATCTCGAGATCCTCCAGGTAGTACAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152770.1-418s1c1
Sequence:CCGGGCAAGAGATATCAGGATACATCTCGAGATGTATCCTGATATCTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152770.1-127s1c1
Sequence:CCGGGCAGATCACTACTGTGGACTTCTCGAGAAGTCCACAGTAGTGATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152770.1-103s1c1
Sequence:CCGGCGCCTATGAAGATTTCCTGGACTCGAGTCCAGGAAATCTTCATAGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152770.1-89s1c1
Sequence:CCGGGTCACTCAATTCAACGCCTATCTCGAGATAGGCGTTGAATTGAGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152770.1-590s1c1
Sequence:CCGGGATAATCCAGAAGGCTTACTTCTCGAGAAGTAAGCCTTCTGGATTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152770.1-305s1c1
Sequence:CCGGGCTGGTAAAGACCTACAAGATCTCGAGATCTTGTAGGTCTTTACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152770.1-344s1c1
Sequence:CCGGGCAATGAGAGAAGAAGACAATCTCGAGATTGTCTTCTTCTCTCATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152770.1-307s21c1
Sequence:CCGGTGGTAAAGACCTACAAGATAACTCGAGTTATCTTGTAGGTCTTTACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152770.1-440s21c1
Sequence:CCGGGACTATGCCCACAGGCTAAAGCTCGAGCTTTAGCCTGTGGGCATAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152770.1-746s21c1
Sequence:CCGGACTTAAGTACCAACATGTTAACTCGAGTTAACATGTTGGTACTTAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152770
C4orf22 MISSION shRNA shRNA Plasmid DNA
chromosome 4 open reading frame 22
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152770.1-143s1c1
Sequence:CCGGGACTTGTACTACCTGGAGGATCTCGAGATCCTCCAGGTAGTACAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152770.1-418s1c1
Sequence:CCGGGCAAGAGATATCAGGATACATCTCGAGATGTATCCTGATATCTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152770.1-127s1c1
Sequence:CCGGGCAGATCACTACTGTGGACTTCTCGAGAAGTCCACAGTAGTGATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152770.1-103s1c1
Sequence:CCGGCGCCTATGAAGATTTCCTGGACTCGAGTCCAGGAAATCTTCATAGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152770.1-89s1c1
Sequence:CCGGGTCACTCAATTCAACGCCTATCTCGAGATAGGCGTTGAATTGAGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152770.1-590s1c1
Sequence:CCGGGATAATCCAGAAGGCTTACTTCTCGAGAAGTAAGCCTTCTGGATTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152770.1-305s1c1
Sequence:CCGGGCTGGTAAAGACCTACAAGATCTCGAGATCTTGTAGGTCTTTACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152770.1-344s1c1
Sequence:CCGGGCAATGAGAGAAGAAGACAATCTCGAGATTGTCTTCTTCTCTCATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152770.1-307s21c1
Sequence:CCGGTGGTAAAGACCTACAAGATAACTCGAGTTATCTTGTAGGTCTTTACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152770.1-440s21c1
Sequence:CCGGGACTATGCCCACAGGCTAAAGCTCGAGCTTTAGCCTGTGGGCATAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152770.1-746s21c1
Sequence:CCGGACTTAAGTACCAACATGTTAACTCGAGTTAACATGTTGGTACTTAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152770
C4orf22 MISSION shRNA Lentiviral Transduction Particles
chromosome 4 open reading frame 22
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152770.1-143s1c1
Sequence:CCGGGACTTGTACTACCTGGAGGATCTCGAGATCCTCCAGGTAGTACAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152770.1-418s1c1
Sequence:CCGGGCAAGAGATATCAGGATACATCTCGAGATGTATCCTGATATCTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152770.1-127s1c1
Sequence:CCGGGCAGATCACTACTGTGGACTTCTCGAGAAGTCCACAGTAGTGATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152770.1-103s1c1
Sequence:CCGGCGCCTATGAAGATTTCCTGGACTCGAGTCCAGGAAATCTTCATAGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152770.1-89s1c1
Sequence:CCGGGTCACTCAATTCAACGCCTATCTCGAGATAGGCGTTGAATTGAGTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152770.1-590s1c1
Sequence:CCGGGATAATCCAGAAGGCTTACTTCTCGAGAAGTAAGCCTTCTGGATTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152770.1-305s1c1
Sequence:CCGGGCTGGTAAAGACCTACAAGATCTCGAGATCTTGTAGGTCTTTACCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152770.1-344s1c1
Sequence:CCGGGCAATGAGAGAAGAAGACAATCTCGAGATTGTCTTCTTCTCTCATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152770.1-307s21c1
Sequence:CCGGTGGTAAAGACCTACAAGATAACTCGAGTTATCTTGTAGGTCTTTACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152770.1-440s21c1
Sequence:CCGGGACTATGCCCACAGGCTAAAGCTCGAGCTTTAGCCTGTGGGCATAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152770.1-746s21c1
Sequence:CCGGACTTAAGTACCAACATGTTAACTCGAGTTAACATGTTGGTACTTAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)