EMAIL THIS PAGE TO A FRIEND

C4orf48

chromosome 4 open reading frame 48

37 Gene Product Result for
Synonyms: CHR4_55
Species: Human C4orf48(401115)
UniProtKB ID: Q5BLP8, B6ZDN0, B7ZBI7, B7ZBI8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA052447 Anti-C4orf48 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001141936 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001141936 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001141936 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001716080 Rosetta Predictions human pricing
XM_379250 Rosetta Predictions human pricing
XM_937968 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001716080 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00408053 predicted 419
2 SASI_Hs02_00408054 predicted 417
3 SASI_Hs02_00408055 predicted 433
4 SASI_Hs02_00408056 predicted 310
5 SASI_Hs02_00408057 predicted 339
6 SASI_Hs02_00408058 predicted 423
7 SASI_Hs02_00408059 predicted 338
8 SASI_Hs02_00408060 predicted 419
9 SASI_Hs02_00408061 predicted 279
10 SASI_Hs02_00408062 predicted 51
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_379250 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00300458 predicted 422
2 SASI_Hs01_00300459 predicted 421
3 SASI_Hs02_00479815 predicted 432
4 SASI_Hs01_00300460 predicted 303
5 SASI_Hs01_00300461 predicted 339
6 SASI_Hs02_00479816 predicted 424
7 SASI_Hs01_00300462 predicted 338
8 SASI_Hs01_00300464 predicted 426
9 SASI_Hs01_00300465 predicted 274
10 SASI_Hs01_00300466 predicted 46
11 SASI_Hs01_00300463 predicted 427
12 SASI_Hs01_00300467 predicted 358
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_937968 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00482794 predicted 423
2 SASI_Hs02_00482795 predicted 417
3 SASI_Hs02_00482796 predicted 424
4 SASI_Hs02_00482797 predicted 309
5 SASI_Hs02_00482798 predicted 338
6 SASI_Hs02_00482799 predicted 418
7 SASI_Hs02_00482800 predicted 338
8 SASI_Hs02_00482801 predicted 420
9 SASI_Hs02_00482802 predicted 279
10 SASI_Hs02_00482803 predicted 48
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001141936
C4orf48 MISSION shRNA Bacterial Glycerol Stock
chromosome 4 open reading frame 48
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000256988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141936.1-196s21c1
Sequence:CCGGCTGCTGAGTCTGGCGCTGCTGCTCGAGCAGCAGCGCCAGACTCAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141936.1-273s21c1
Sequence:CCGGATGCGTGGACTGCCACGCCTTCTCGAGAAGGCGTGGCAGTCCACGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141936.1-52s21c1
Sequence:CCGGACGCGGAACGTCTGCCGGTGTCTCGAGACACCGGCAGACGTTCCGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001141936
C4orf48 MISSION shRNA shRNA Plasmid DNA
chromosome 4 open reading frame 48
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000256988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141936.1-196s21c1
Sequence:CCGGCTGCTGAGTCTGGCGCTGCTGCTCGAGCAGCAGCGCCAGACTCAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141936.1-273s21c1
Sequence:CCGGATGCGTGGACTGCCACGCCTTCTCGAGAAGGCGTGGCAGTCCACGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141936.1-52s21c1
Sequence:CCGGACGCGGAACGTCTGCCGGTGTCTCGAGACACCGGCAGACGTTCCGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001141936
C4orf48 MISSION shRNA Lentiviral Transduction Particles
chromosome 4 open reading frame 48
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000256988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141936.1-196s21c1
Sequence:CCGGCTGCTGAGTCTGGCGCTGCTGCTCGAGCAGCAGCGCCAGACTCAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141936.1-273s21c1
Sequence:CCGGATGCGTGGACTGCCACGCCTTCTCGAGAAGGCGTGGCAGTCCACGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141936.1-52s21c1
Sequence:CCGGACGCGGAACGTCTGCCGGTGTCTCGAGACACCGGCAGACGTTCCGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)