EMAIL THIS PAGE TO A FRIEND

C5orf38

chromosome 5 open reading frame 38

16 Gene Product Result for
Synonyms: CEI IRX2NB
Species: Human C5orf38(153571)
UniProtKB ID: Q86SI9
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA073667 Anti-C5orf38 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178569 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178569 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178569 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178569 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178569 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228492 predicted 219
2 SASI_Hs01_00228493 predicted 300
3 SASI_Hs01_00228494 predicted 306
4 SASI_Hs01_00228495 predicted 422
5 SASI_Hs01_00228496 predicted 426
6 SASI_Hs01_00228497 predicted 423
7 SASI_Hs01_00228498 predicted 380
8 SASI_Hs01_00228499 predicted 312
9 SASI_Hs02_00369820 predicted 305
10 SASI_Hs01_00228500 predicted 424
11 SASI_Hs01_00228501 predicted 317
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178569
C5orf38 MISSION shRNA Bacterial Glycerol Stock
chromosome 5 open reading frame 38
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178569.2-542s21c1
Sequence:CCGGCTACGTGGACACGCAAGTTTCCTCGAGGAAACTTGCGTGTCCACGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178569.2-343s21c1
Sequence:CCGGGATGATTGTTACCTGACAAACCTCGAGGTTTGTCAGGTAACAATCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178569.2-514s21c1
Sequence:CCGGGGCTCCCGCCAAAGAATTTAGCTCGAGCTAAATTCTTTGGCGGGAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178569.2-312s21c1
Sequence:CCGGCCTGAGATTTGTGTTGTCAAACTCGAGTTTGACAACACAAATCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178569.2-459s1c1
Sequence:CCGGGAACCAGTTGCAAACTGCAGTCTCGAGACTGCAGTTTGCAACTGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178569.2-311s1c1
Sequence:CCGGCCCTGAGATTTGTGTTGTCAACTCGAGTTGACAACACAAATCTCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178569
C5orf38 MISSION shRNA shRNA Plasmid DNA
chromosome 5 open reading frame 38
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178569.2-542s21c1
Sequence:CCGGCTACGTGGACACGCAAGTTTCCTCGAGGAAACTTGCGTGTCCACGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178569.2-343s21c1
Sequence:CCGGGATGATTGTTACCTGACAAACCTCGAGGTTTGTCAGGTAACAATCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178569.2-514s21c1
Sequence:CCGGGGCTCCCGCCAAAGAATTTAGCTCGAGCTAAATTCTTTGGCGGGAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178569.2-312s21c1
Sequence:CCGGCCTGAGATTTGTGTTGTCAAACTCGAGTTTGACAACACAAATCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178569.2-459s1c1
Sequence:CCGGGAACCAGTTGCAAACTGCAGTCTCGAGACTGCAGTTTGCAACTGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178569.2-311s1c1
Sequence:CCGGCCCTGAGATTTGTGTTGTCAACTCGAGTTGACAACACAAATCTCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178569
C5orf38 MISSION shRNA Lentiviral Transduction Particles
chromosome 5 open reading frame 38
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282733    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178569.2-542s21c1
Sequence:CCGGCTACGTGGACACGCAAGTTTCCTCGAGGAAACTTGCGTGTCCACGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178569.2-343s21c1
Sequence:CCGGGATGATTGTTACCTGACAAACCTCGAGGTTTGTCAGGTAACAATCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178569.2-514s21c1
Sequence:CCGGGGCTCCCGCCAAAGAATTTAGCTCGAGCTAAATTCTTTGGCGGGAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178569.2-312s21c1
Sequence:CCGGCCTGAGATTTGTGTTGTCAAACTCGAGTTTGACAACACAAATCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178569.2-459s1c1
Sequence:CCGGGAACCAGTTGCAAACTGCAGTCTCGAGACTGCAGTTTGCAACTGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178569.2-311s1c1
Sequence:CCGGCCCTGAGATTTGTGTTGTCAACTCGAGTTGACAACACAAATCTCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)