EMAIL THIS PAGE TO A FRIEND

C7orf13

chromosome 7 open reading frame 13

53 Gene Product Result for
Synonyms: MY040
Species: Human C7orf13(129790)
UniProtKB ID: Q8NI28
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032625 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032625 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032625 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU225781 MISSION® esiRNA esiRNA targeting human C7orf13 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032625 Rosetta Predictions human pricing
XR_040519 Rosetta Predictions human pricing
XR_040520 Rosetta Predictions human pricing
XR_040521 Rosetta Predictions human pricing
XR_040522 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032625 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034855 predicted 993
2 SASI_Hs01_00034856 predicted 1116
3 SASI_Hs01_00034857 predicted 1398
4 SASI_Hs01_00034858 predicted 1157
5 SASI_Hs01_00034859 predicted 993
6 SASI_Hs01_00034860 predicted 1021
7 SASI_Hs01_00034861 predicted 1199
8 SASI_Hs01_00034862 predicted 1688
9 SASI_Hs01_00034863 predicted 1806
10 SASI_Hs01_00034864 predicted 1821
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040519 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00519623 predicted 657
2 SASI_Hs02_00519624 predicted 1800
3 SASI_Hs02_00519625 predicted 1791
4 SASI_Hs02_00519626 predicted 536
5 SASI_Hs02_00519627 predicted 523
6 SASI_Hs02_00519628 predicted 395
7 SASI_Hs02_00519629 predicted 748
8 SASI_Hs02_00519630 predicted 541
9 SASI_Hs02_00519631 predicted 714
10 SASI_Hs02_00519632 predicted 640
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040520 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00519633 predicted 656
2 SASI_Hs02_00519634 predicted 1797
3 SASI_Hs02_00519635 predicted 1787
4 SASI_Hs02_00519636 predicted 533
5 SASI_Hs02_00519637 predicted 518
6 SASI_Hs02_00519638 predicted 402
7 SASI_Hs02_00519639 predicted 743
8 SASI_Hs02_00519640 predicted 538
9 SASI_Hs02_00519641 predicted 719
10 SASI_Hs02_00519642 predicted 644
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040521 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00519643 predicted 656
2 SASI_Hs02_00519644 predicted 1791
3 SASI_Hs02_00519645 predicted 1798
4 SASI_Hs02_00519646 predicted 536
5 SASI_Hs02_00519647 predicted 522
6 SASI_Hs02_00519648 predicted 394
7 SASI_Hs02_00519649 predicted 743
8 SASI_Hs02_00519650 predicted 536
9 SASI_Hs02_00519651 predicted 719
10 SASI_Hs02_00519652 predicted 649
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040522 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00519653 predicted 660
2 SASI_Hs02_00519654 predicted 1799
3 SASI_Hs02_00519655 predicted 1785
4 SASI_Hs02_00519656 predicted 538
5 SASI_Hs02_00519657 predicted 520
6 SASI_Hs02_00519658 predicted 402
7 SASI_Hs02_00519659 predicted 743
8 SASI_Hs02_00519660 predicted 542
9 SASI_Hs02_00519661 predicted 716
10 SASI_Hs02_00519662 predicted 644
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032625
C7orf13 MISSION shRNA Bacterial Glycerol Stock
chromosome 7 open reading frame 13
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000167184    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032625.1-1217s1c1
Sequence:CCGGCCATAAATGGTTGTAAGACTTCTCGAGAAGTCTTACAACCATTTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166963    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032625.1-954s1c1
Sequence:CCGGGAAGCAGAAATGAGTAAAGTTCTCGAGAACTTTACTCATTTCTGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032625.1-826s1c1
Sequence:CCGGGCTTCCCTTCTCTTAAGGATCCTCGAGGATCCTTAAGAGAAGGGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032625
C7orf13 MISSION shRNA shRNA Plasmid DNA
chromosome 7 open reading frame 13
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000167184    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032625.1-1217s1c1
Sequence:CCGGCCATAAATGGTTGTAAGACTTCTCGAGAAGTCTTACAACCATTTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166963    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032625.1-954s1c1
Sequence:CCGGGAAGCAGAAATGAGTAAAGTTCTCGAGAACTTTACTCATTTCTGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032625.1-826s1c1
Sequence:CCGGGCTTCCCTTCTCTTAAGGATCCTCGAGGATCCTTAAGAGAAGGGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032625
C7orf13 MISSION shRNA Lentiviral Transduction Particles
chromosome 7 open reading frame 13
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000167184    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032625.1-1217s1c1
Sequence:CCGGCCATAAATGGTTGTAAGACTTCTCGAGAAGTCTTACAACCATTTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166963    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032625.1-954s1c1
Sequence:CCGGGAAGCAGAAATGAGTAAAGTTCTCGAGAACTTTACTCATTTCTGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032625.1-826s1c1
Sequence:CCGGGCTTCCCTTCTCTTAAGGATCCTCGAGGATCCTTAAGAGAAGGGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)