EMAIL THIS PAGE TO A FRIEND

C7orf33

chromosome 7 open reading frame 33

55 Gene Product Result for
Species: Human C7orf33(202865)
UniProtKB ID: Q8WU49
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145304 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145304 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145304 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145304 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145304 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219806 predicted 914
2 SASI_Hs01_00219807 predicted 906
3 SASI_Hs02_00365197 predicted 1018
4 SASI_Hs01_00219808 predicted 593
5 SASI_Hs01_00219809 predicted 537
6 SASI_Hs01_00219810 predicted 759
7 SASI_Hs01_00219811 predicted 873
8 SASI_Hs01_00219812 predicted 753
9 SASI_Hs01_00219813 predicted 1047
10 SASI_Hs01_00219814 predicted 520
11 SASI_Hs01_00219815 predicted 759
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145304
C7orf33 MISSION shRNA Bacterial Glycerol Stock
chromosome 7 open reading frame 33
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145304.2-911s21c1
Sequence:CCGGTAAGAGTCACACCTCTAAATTCTCGAGAATTTAGAGGTGTGACTCTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167379    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145304.2-933s1c1
Sequence:CCGGGTGTAGATTGTGAAATCTCTTCTCGAGAAGAGATTTCACAATCTACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145304.2-794s21c1
Sequence:CCGGAGGACAGTGACAAGTTCATACCTCGAGGTATGAACTTGTCACTGTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145304.2-552s1c1
Sequence:CCGGCGGGAAGACATAAGAAGCCAACTCGAGTTGGCTTCTTATGTCTTCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145304.2-833s1c1
Sequence:CCGGGAAGTAAGAAAGCTCCAGAATCTCGAGATTCTGGAGCTTTCTTACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145304.2-525s1c1
Sequence:CCGGCAGGTCAATTTAACTTGTCATCTCGAGATGACAAGTTAAATTGACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167557    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145304.2-982s1c1
Sequence:CCGGGTTCTGGAAATAACAGTTGATCTCGAGATCAACTGTTATTTCCAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145304.2-421s1c1
Sequence:CCGGCCAATGTGAATGTGAAGCCCTCTCGAGAGGGCTTCACATTCACATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429159    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145304.2-1094s21c1
Sequence:CCGGGCAGGAATCTGTGTGGCATTTCTCGAGAAATGCCACACAGATTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145304
C7orf33 MISSION shRNA shRNA Plasmid DNA
chromosome 7 open reading frame 33
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145304.2-911s21c1
Sequence:CCGGTAAGAGTCACACCTCTAAATTCTCGAGAATTTAGAGGTGTGACTCTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167379    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145304.2-933s1c1
Sequence:CCGGGTGTAGATTGTGAAATCTCTTCTCGAGAAGAGATTTCACAATCTACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145304.2-794s21c1
Sequence:CCGGAGGACAGTGACAAGTTCATACCTCGAGGTATGAACTTGTCACTGTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145304.2-552s1c1
Sequence:CCGGCGGGAAGACATAAGAAGCCAACTCGAGTTGGCTTCTTATGTCTTCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145304.2-833s1c1
Sequence:CCGGGAAGTAAGAAAGCTCCAGAATCTCGAGATTCTGGAGCTTTCTTACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145304.2-525s1c1
Sequence:CCGGCAGGTCAATTTAACTTGTCATCTCGAGATGACAAGTTAAATTGACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167557    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145304.2-982s1c1
Sequence:CCGGGTTCTGGAAATAACAGTTGATCTCGAGATCAACTGTTATTTCCAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145304.2-421s1c1
Sequence:CCGGCCAATGTGAATGTGAAGCCCTCTCGAGAGGGCTTCACATTCACATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429159    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145304.2-1094s21c1
Sequence:CCGGGCAGGAATCTGTGTGGCATTTCTCGAGAAATGCCACACAGATTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145304
C7orf33 MISSION shRNA Lentiviral Transduction Particles
chromosome 7 open reading frame 33
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145304.2-911s21c1
Sequence:CCGGTAAGAGTCACACCTCTAAATTCTCGAGAATTTAGAGGTGTGACTCTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167379    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145304.2-933s1c1
Sequence:CCGGGTGTAGATTGTGAAATCTCTTCTCGAGAAGAGATTTCACAATCTACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145304.2-794s21c1
Sequence:CCGGAGGACAGTGACAAGTTCATACCTCGAGGTATGAACTTGTCACTGTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145304.2-552s1c1
Sequence:CCGGCGGGAAGACATAAGAAGCCAACTCGAGTTGGCTTCTTATGTCTTCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145304.2-833s1c1
Sequence:CCGGGAAGTAAGAAAGCTCCAGAATCTCGAGATTCTGGAGCTTTCTTACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145304.2-525s1c1
Sequence:CCGGCAGGTCAATTTAACTTGTCATCTCGAGATGACAAGTTAAATTGACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167557    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145304.2-982s1c1
Sequence:CCGGGTTCTGGAAATAACAGTTGATCTCGAGATCAACTGTTATTTCCAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145304.2-421s1c1
Sequence:CCGGCCAATGTGAATGTGAAGCCCTCTCGAGAGGGCTTCACATTCACATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429159    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145304.2-1094s21c1
Sequence:CCGGGCAGGAATCTGTGTGGCATTTCTCGAGAAATGCCACACAGATTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)