EMAIL THIS PAGE TO A FRIEND

CA5B

carbonic anhydrase VB, mitochondrial

122 Gene Product Result for
Synonyms: CA-VB
UniProtKB ID: Q9Y2D0, A8K4T5
Gene ID:
Human(11238) Summary: Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. CA VB is localized in the mitochondria and shows the highest sequence similarity to the other mitochondrial CA, CA VA. It has a wider tissue distribution than CA VA, which is restricted to the liver. The differences in tissue distribution suggest that the two mitochondrial carbonic anhydrases evolved to assume different physiologic roles. [provided by RefSeq, Jul 2008]
chicken(415833) carbonic anhydrase VB, mitochondrial
cow(514494) carbonic anhydrase VB, mitochondrial
domestic cat(101096288) carbonic anhydrase VB, mitochondrial
dog(486453) carbonic anhydrase VB, mitochondrial
sheep(101104372) carbonic anhydrase VB, mitochondrial
domestic guinea pig(100736170) carbonic anhydrase VB, mitochondrial
naked mole-rat(101698460) carbonic anhydrase VB, mitochondrial
Gene Class: Dehydratase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1306 Human CA5B ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007220 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007220 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007220 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU131731 MISSION® esiRNA esiRNA human CA5B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007220 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007220 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215088 predicted 221
2 SASI_Hs01_00215089 predicted 870
3 SASI_Hs01_00215090 predicted 688
4 SASI_Hs01_00215091 predicted 487
5 SASI_Hs01_00215092 predicted 703
6 SASI_Hs01_00215093 predicted 439
7 SASI_Hs01_00215094 predicted 217
8 SASI_Hs02_00343222 predicted 851
9 SASI_Hs01_00215095 predicted 486
10 SASI_Hs02_00343223 predicted 860
11 SASI_Hs01_00215087 predicted 1003
12 SASI_Hs01_00215096 predicted 676
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007220
CA5B MISSION shRNA Bacterial Glycerol Stock
carbonic anhydrase VB, mitochondrial
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007220.2-960s1c1
Sequence:CCGGCCACTGATGAATCGCACTGTTCTCGAGAACAGTGCGATTCATCAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007220.2-476s1c1
Sequence:CCGGCCGATTGAAGCAGTTCCATTTCTCGAGAAATGGAACTGCTTCAATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007220.2-993s1c1
Sequence:CCGGCGGCATGATTATGTGCTGAATCTCGAGATTCAGCACATAATCATGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007220.2-855s1c1
Sequence:CCGGCCAGTAGAGGTTGATCATGATCTCGAGATCATGATCAACCTCTACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151377    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007220.2-1978s1c1
Sequence:CCGGGCACGCTGTTACATAGTATATCTCGAGATATACTATGTAACAGCGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151476    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007220.2-2040s1c1
Sequence:CCGGCCTTTACAACTGTCTGAACTTCTCGAGAAGTTCAGACAGTTGTAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007220.2-1706s1c1
Sequence:CCGGCCCAGTGTTTAGTTGTTACAACTCGAGTTGTAACAACTAAACACTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007220.2-205s1c1
Sequence:CCGGGCAGCCTCTATACTTGTACTTCTCGAGAAGTACAAGTATAGAGGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007220.2-728s1c1
Sequence:CCGGCCTTGTGGAATTTGGGTCATTCTCGAGAATGACCCAAATTCCACAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153742    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007220.2-1809s1c1
Sequence:CCGGCCCAGAAATCCCTTTGCATTTCTCGAGAAATGCAAAGGGATTTCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007220
CA5B MISSION shRNA shRNA Plasmid DNA
carbonic anhydrase VB, mitochondrial
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007220.2-960s1c1
Sequence:CCGGCCACTGATGAATCGCACTGTTCTCGAGAACAGTGCGATTCATCAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007220.2-476s1c1
Sequence:CCGGCCGATTGAAGCAGTTCCATTTCTCGAGAAATGGAACTGCTTCAATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007220.2-993s1c1
Sequence:CCGGCGGCATGATTATGTGCTGAATCTCGAGATTCAGCACATAATCATGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007220.2-855s1c1
Sequence:CCGGCCAGTAGAGGTTGATCATGATCTCGAGATCATGATCAACCTCTACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151377    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007220.2-1978s1c1
Sequence:CCGGGCACGCTGTTACATAGTATATCTCGAGATATACTATGTAACAGCGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151476    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007220.2-2040s1c1
Sequence:CCGGCCTTTACAACTGTCTGAACTTCTCGAGAAGTTCAGACAGTTGTAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007220.2-1706s1c1
Sequence:CCGGCCCAGTGTTTAGTTGTTACAACTCGAGTTGTAACAACTAAACACTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007220.2-205s1c1
Sequence:CCGGGCAGCCTCTATACTTGTACTTCTCGAGAAGTACAAGTATAGAGGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007220.2-728s1c1
Sequence:CCGGCCTTGTGGAATTTGGGTCATTCTCGAGAATGACCCAAATTCCACAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153742    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007220.2-1809s1c1
Sequence:CCGGCCCAGAAATCCCTTTGCATTTCTCGAGAAATGCAAAGGGATTTCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007220
CA5B MISSION shRNA Lentiviral Transduction Particles
carbonic anhydrase VB, mitochondrial
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007220.2-960s1c1
Sequence:CCGGCCACTGATGAATCGCACTGTTCTCGAGAACAGTGCGATTCATCAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007220.2-476s1c1
Sequence:CCGGCCGATTGAAGCAGTTCCATTTCTCGAGAAATGGAACTGCTTCAATCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007220.2-993s1c1
Sequence:CCGGCGGCATGATTATGTGCTGAATCTCGAGATTCAGCACATAATCATGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007220.2-855s1c1
Sequence:CCGGCCAGTAGAGGTTGATCATGATCTCGAGATCATGATCAACCTCTACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151377    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007220.2-1978s1c1
Sequence:CCGGGCACGCTGTTACATAGTATATCTCGAGATATACTATGTAACAGCGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151476    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007220.2-2040s1c1
Sequence:CCGGCCTTTACAACTGTCTGAACTTCTCGAGAAGTTCAGACAGTTGTAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007220.2-1706s1c1
Sequence:CCGGCCCAGTGTTTAGTTGTTACAACTCGAGTTGTAACAACTAAACACTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007220.2-205s1c1
Sequence:CCGGGCAGCCTCTATACTTGTACTTCTCGAGAAGTACAAGTATAGAGGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007220.2-728s1c1
Sequence:CCGGCCTTGTGGAATTTGGGTCATTCTCGAGAATGACCCAAATTCCACAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153742    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007220.2-1809s1c1
Sequence:CCGGCCCAGAAATCCCTTTGCATTTCTCGAGAAATGCAAAGGGATTTCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)