EMAIL THIS PAGE TO A FRIEND

CABP4

calcium binding protein 4

55 Gene Product Result for
Synonyms: CSNB2B
UniProtKB ID: P57796, Q8N4Z2, Q8WWY5
Gene ID:
Human(57010) Summary: This gene encodes a member of the CABP family of calcium binding protein characterized by four EF-hand motifs. Mutations in this gene are associated with congenital stationary night blindness type 2B. [provided by RefSeq, Mar 2010]
Mouse(73660) calcium binding protein 4
Rat(365394) calcium binding protein 4
Zebrafish(797905) calcium binding protein 4
domestic cat(101081413) calcium binding protein 4
cow(281656) calcium binding protein 4
dog(483694) calcium binding protein 4
chicken(100857896) calcium-binding protein 4
domestic guinea pig(100722978) calcium binding protein 4
naked mole-rat(101702208) calcium binding protein 4
sheep(101110374) calcium binding protein 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144532 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144532 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144532 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145200 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145200 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145200 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145200 Rosetta Predictions human pricing
NM_001108926 Rosetta Predictions rat pricing
XM_344981 Rosetta Predictions rat pricing
NM_144532 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145200 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068789 predicted 861
2 SASI_Hs01_00068790 predicted 497
3 SASI_Hs01_00068791 predicted 629
4 SASI_Hs01_00068792 predicted 636
5 SASI_Hs01_00068793 predicted 856
6 SASI_Hs01_00068794 predicted 635
7 SASI_Hs01_00068795 predicted 870
8 SASI_Hs01_00068796 predicted 649
9 SASI_Hs01_00068797 predicted 807
10 SASI_Hs01_00068798 predicted 858
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108926 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243444 predicted 922
2 SASI_Rn02_00243445 predicted 287
3 SASI_Rn02_00243446 predicted 963
4 SASI_Rn02_00243447 predicted 809
5 SASI_Rn02_00243448 predicted 703
6 SASI_Rn02_00243449 predicted 348
7 SASI_Rn02_00243450 predicted 1057
8 SASI_Rn02_00243451 predicted 870
9 SASI_Rn02_00243452 predicted 819
10 SASI_Rn02_00243453 predicted 1086
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344981 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00160499 predicted 335
2 SASI_Rn01_00160500 predicted 418
3 SASI_Rn01_00160501 predicted 557
4 SASI_Rn01_00160502 predicted 230
5 SASI_Rn01_00160503 predicted 398
6 SASI_Rn01_00160504 predicted 247
7 SASI_Rn01_00160505 predicted 288
8 SASI_Rn01_00160506 predicted 488
9 SASI_Rn01_00160507 predicted 300
10 SASI_Rn01_00160508 predicted 446
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144532 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065849 predicted 602
2 SASI_Mm01_00065850 predicted 535
3 SASI_Mm01_00065851 predicted 532
4 SASI_Mm01_00065852 predicted 396
5 SASI_Mm01_00065853 predicted 608
6 SASI_Mm01_00065854 predicted 349
7 SASI_Mm01_00065855 predicted 817
8 SASI_Mm01_00065856 predicted 349
9 SASI_Mm01_00065857 predicted 814
10 SASI_Mm01_00065858 predicted 367
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144532
CABP4 MISSION shRNA Bacterial Glycerol Stock
calcium binding protein 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144532.2-838s1c1
Sequence:CCGGACGAGTTTGTAATGATGCTATCTCGAGATAGCATCATTACAAACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144532.2-381s1c1
Sequence:CCGGCCCTTGCTCAACCGCATGTTTCTCGAGAAACATGCGGTTGAGCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144532.2-97s1c1
Sequence:CCGGAGATCCCTAAAGGAGTTGTATCTCGAGATACAACTCCTTTAGGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144532.2-534s1c1
Sequence:CCGGCCCACGGAGATGGAGCTTCTACTCGAGTAGAAGCTCCATCTCCGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144532.2-783s1c1
Sequence:CCGGCTGGATGAGATGTTGCGAGAACTCGAGTTCTCGCAACATCTCATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144532
CABP4 MISSION shRNA shRNA Plasmid DNA
calcium binding protein 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144532.2-838s1c1
Sequence:CCGGACGAGTTTGTAATGATGCTATCTCGAGATAGCATCATTACAAACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144532.2-381s1c1
Sequence:CCGGCCCTTGCTCAACCGCATGTTTCTCGAGAAACATGCGGTTGAGCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144532.2-97s1c1
Sequence:CCGGAGATCCCTAAAGGAGTTGTATCTCGAGATACAACTCCTTTAGGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144532.2-534s1c1
Sequence:CCGGCCCACGGAGATGGAGCTTCTACTCGAGTAGAAGCTCCATCTCCGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144532.2-783s1c1
Sequence:CCGGCTGGATGAGATGTTGCGAGAACTCGAGTTCTCGCAACATCTCATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144532
CABP4 MISSION shRNA Lentiviral Transduction Particles
calcium binding protein 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144532.2-838s1c1
Sequence:CCGGACGAGTTTGTAATGATGCTATCTCGAGATAGCATCATTACAAACTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144532.2-381s1c1
Sequence:CCGGCCCTTGCTCAACCGCATGTTTCTCGAGAAACATGCGGTTGAGCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144532.2-97s1c1
Sequence:CCGGAGATCCCTAAAGGAGTTGTATCTCGAGATACAACTCCTTTAGGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144532.2-534s1c1
Sequence:CCGGCCCACGGAGATGGAGCTTCTACTCGAGTAGAAGCTCCATCTCCGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144532.2-783s1c1
Sequence:CCGGCTGGATGAGATGTTGCGAGAACTCGAGTTCTCGCAACATCTCATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145200
CABP4 MISSION shRNA Bacterial Glycerol Stock
calcium binding protein 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145200.1-647s1c1
Sequence:CCGGTGTAGAACTGATAGGCCCAAACTCGAGTTTGGGCCTATCAGTTCTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145200.1-711s1c1
Sequence:CCGGCGCATCGCCTTCCGAGAGTTTCTCGAGAAACTCTCGGAAGGCGATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145200.1-860s1c1
Sequence:CCGGCACCGTAGACTTTGACGAGTTCTCGAGAACTCGTCAAAGTCTACGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145200.1-639s1c1
Sequence:CCGGGAGGAGTTTGTAGAACTGATACTCGAGTATCAGTTCTACAAACTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145200.1-459s1c1
Sequence:CCGGCCCGAGGAGCTAGACGAGCTTCTCGAGAAGCTCGTCTAGCTCCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145200.3-737s21c1
Sequence:CCGGGGACAGGGATGGACGAATTACCTCGAGGTAATTCGTCCATCCCTGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145200.3-905s21c1
Sequence:CCGGAGGCTCCAGGAGGGAATATCTCTCGAGAGATATTCCCTCCTGGAGCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145200.3-1262s21c1
Sequence:CCGGCCCTTCCACTACTTATGTTTACTCGAGTAAACATAAGTAGTGGAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145200.3-1045s21c1
Sequence:CCGGGCCTCAATGTTGGCTTGTTATCTCGAGATAACAAGCCAACATTGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145200
CABP4 MISSION shRNA shRNA Plasmid DNA
calcium binding protein 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145200.1-647s1c1
Sequence:CCGGTGTAGAACTGATAGGCCCAAACTCGAGTTTGGGCCTATCAGTTCTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145200.1-711s1c1
Sequence:CCGGCGCATCGCCTTCCGAGAGTTTCTCGAGAAACTCTCGGAAGGCGATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145200.1-860s1c1
Sequence:CCGGCACCGTAGACTTTGACGAGTTCTCGAGAACTCGTCAAAGTCTACGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145200.1-639s1c1
Sequence:CCGGGAGGAGTTTGTAGAACTGATACTCGAGTATCAGTTCTACAAACTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145200.1-459s1c1
Sequence:CCGGCCCGAGGAGCTAGACGAGCTTCTCGAGAAGCTCGTCTAGCTCCTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000447483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145200.3-737s21c1
Sequence:CCGGGGACAGGGATGGACGAATTACCTCGAGGTAATTCGTCCATCCCTGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145200.3-905s21c1
Sequence:CCGGAGGCTCCAGGAGGGAATATCTCTCGAGAGATATTCCCTCCTGGAGCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145200.3-1262s21c1
Sequence:CCGGCCCTTCCACTACTTATGTTTACTCGAGTAAACATAAGTAGTGGAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145200.3-1045s21c1
Sequence:CCGGGCCTCAATGTTGGCTTGTTATCTCGAGATAACAAGCCAACATTGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145200
CABP4 MISSION shRNA Lentiviral Transduction Particles
calcium binding protein 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145200.1-647s1c1
Sequence:CCGGTGTAGAACTGATAGGCCCAAACTCGAGTTTGGGCCTATCAGTTCTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145200.1-711s1c1
Sequence:CCGGCGCATCGCCTTCCGAGAGTTTCTCGAGAAACTCTCGGAAGGCGATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145200.1-860s1c1
Sequence:CCGGCACCGTAGACTTTGACGAGTTCTCGAGAACTCGTCAAAGTCTACGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145200.1-639s1c1
Sequence:CCGGGAGGAGTTTGTAGAACTGATACTCGAGTATCAGTTCTACAAACTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145200.1-459s1c1
Sequence:CCGGCCCGAGGAGCTAGACGAGCTTCTCGAGAAGCTCGTCTAGCTCCTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145200.3-737s21c1
Sequence:CCGGGGACAGGGATGGACGAATTACCTCGAGGTAATTCGTCCATCCCTGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145200.3-905s21c1
Sequence:CCGGAGGCTCCAGGAGGGAATATCTCTCGAGAGATATTCCCTCCTGGAGCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145200.3-1262s21c1
Sequence:CCGGCCCTTCCACTACTTATGTTTACTCGAGTAAACATAAGTAGTGGAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145200.3-1045s21c1
Sequence:CCGGGCCTCAATGTTGGCTTGTTATCTCGAGATAACAAGCCAACATTGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)