EMAIL THIS PAGE TO A FRIEND

CABYR

calcium binding tyrosine-(Y)-phosphorylation regulated

158 Gene Product Result for
Synonyms: CABYRa CABYRc CABYRc/d CABYRe CBP86 CT88 FSP-2 FSP2
Gene ID:
Human(26256) Summary: To reach fertilization competence, spermatozoa undergo a series of morphological and molecular maturational processes, termed capacitation, involving protein tyrosine phosphorylation and increased intracellular calcium. The protein encoded by this gene localizes to the principal piece of the sperm flagellum in association with the fibrous sheath and exhibits calcium-binding when phosphorylated during capacitation. A pseudogene on chromosome 3 has been identified for this gene. Alternatively spliced transcript variants encoding distinct protein isoforms have been found for this gene. [provided by RefSeq, Jul 2013]
Mouse(71132) calcium-binding tyrosine-(Y)-phosphorylation regulated (fibrousheathin 2)
Rat(686189) calcium binding tyrosine-(Y)-phosphorylation regulated
domestic guinea pig(100716747) calcium binding tyrosine-(Y)-phosphorylation regulated
naked mole-rat(101706764) calcium binding tyrosine-(Y)-phosphorylation regulated
sheep(101119268) calcium binding tyrosine-(Y)-phosphorylation regulated
dog(100270706) calcium binding tyrosine-(Y)-phosphorylation regulated
cow(510319) calcium binding tyrosine-(Y)-phosphorylation regulated
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027687 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027687 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027687 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012189 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012189 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012189 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012189 Rosetta Predictions human pricing
NM_138643 Rosetta Predictions human pricing
NM_138644 Rosetta Predictions human pricing
NM_153768 Rosetta Predictions human pricing
NM_153769 Rosetta Predictions human pricing
NM_153770 Rosetta Predictions human pricing
XM_001072815 Rosetta Predictions rat pricing
NM_001042418 Rosetta Predictions mouse pricing
NM_001042419 Rosetta Predictions mouse pricing
NM_001042420 Rosetta Predictions mouse pricing
NM_027687 Rosetta Predictions mouse pricing
NM_181731 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012189 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343813 predicted 1934
2 SASI_Hs01_00168930 predicted 1992
3 SASI_Hs01_00168931 predicted 2104
4 SASI_Hs02_00343814 predicted 1968
5 SASI_Hs01_00168933 predicted 1990
6 SASI_Hs02_00343815 predicted 1951
7 SASI_Hs02_00343816 predicted 1933
8 SASI_Hs02_00343817 predicted 1883
9 SASI_Hs02_00343818 predicted 1960
10 SASI_Hs02_00343819 predicted 1938
11 SASI_Hs01_00168932 predicted 2002
12 SASI_Hs01_00168934 predicted 1998
13 SASI_Hs01_00168935 predicted 2107
14 SASI_Hs01_00168936 predicted 2054
15 SASI_Hs01_00168937 predicted 2043
16 SASI_Hs01_00168938 predicted 2009
17 SASI_Hs01_00168939 predicted 2050
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138643 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363778 predicted 756
2 SASI_Hs01_00060614 predicted 808
3 SASI_Hs01_00060616 predicted 920
4 SASI_Hs02_00363779 predicted 789
5 SASI_Hs01_00060617 predicted 806
6 SASI_Hs01_00060618 predicted 775
7 SASI_Hs01_00060619 predicted 751
8 SASI_Hs01_00060621 predicted 711
9 SASI_Hs01_00060622 predicted 787
10 SASI_Hs01_00060623 predicted 762
11 SASI_Hs01_00060615 predicted 772
12 SASI_Hs01_00060620 predicted 817
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138644 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363780 predicted 888
2 SASI_Hs01_00192658 predicted 939
3 SASI_Hs01_00192660 predicted 1055
4 SASI_Hs02_00363781 predicted 915
5 SASI_Hs01_00192661 predicted 940
6 SASI_Hs01_00192662 predicted 903
7 SASI_Hs01_00192663 predicted 881
8 SASI_Hs01_00192665 predicted 840
9 SASI_Hs01_00192666 predicted 916
10 SASI_Hs01_00192667 predicted 887
11 SASI_Hs01_00192659 predicted 909
12 SASI_Hs01_00192664 predicted 954
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153768 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367472 predicted 1885
2 SASI_Hs01_00168500 predicted 1935
3 SASI_Hs01_00168501 predicted 2051
4 SASI_Hs02_00367473 predicted 1917
5 SASI_Hs01_00168503 predicted 1932
6 SASI_Hs02_00367474 predicted 1901
7 SASI_Hs02_00367475 predicted 1879
8 SASI_Hs02_00367476 predicted 1830
9 SASI_Hs02_00367477 predicted 1906
10 SASI_Hs02_00367478 predicted 1882
11 SASI_Hs01_00168502 predicted 1946
12 SASI_Hs01_00168504 predicted 1953
13 SASI_Hs01_00168505 predicted 2053
14 SASI_Hs01_00168506 predicted 1999
15 SASI_Hs01_00168507 predicted 1991
16 SASI_Hs01_00168508 predicted 1959
17 SASI_Hs01_00168509 predicted 2001
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153769 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027976 predicted 707
2 SASI_Hs01_00027977 predicted 550
3 SASI_Hs01_00027978 predicted 881
4 SASI_Hs01_00027979 predicted 818
5 SASI_Hs01_00027980 predicted 823
6 SASI_Hs01_00027981 predicted 1145
7 SASI_Hs02_00367479 predicted 1011
8 SASI_Hs01_00027982 predicted 1038
9 SASI_Hs01_00027983 predicted 997
10 SASI_Hs01_00027984 predicted 666
11 SASI_Hs01_00027985 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153770 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065251 predicted 371
2 SASI_Hs02_00367480 predicted 433
3 SASI_Hs01_00065253 predicted 359
4 SASI_Hs01_00065254 predicted 276
5 SASI_Hs02_00367481 predicted 234
6 SASI_Hs01_00065255 predicted 375
7 SASI_Hs01_00065256 predicted 343
8 SASI_Hs01_00065257 predicted 251
9 SASI_Hs01_00065258 predicted 296
10 SASI_Hs01_00065259 predicted 321
11 SASI_Hs01_00065250 predicted 245
12 SASI_Hs01_00065252 predicted 468
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072815 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00340560 predicted 1023
2 SASI_Rn02_00340561 predicted 795
3 SASI_Rn02_00340562 predicted 607
4 SASI_Rn02_00340563 predicted 748
5 SASI_Rn02_00340564 predicted 361
6 SASI_Rn02_00340565 predicted 225
7 SASI_Rn02_00340566 predicted 271
8 SASI_Rn02_00340567 predicted 680
9 SASI_Rn02_00340568 predicted 812
10 SASI_Rn02_00340569 predicted 599
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042418 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164666 predicted 394
2 SASI_Mm01_00164667 predicted 353
3 SASI_Mm01_00164668 predicted 307
4 SASI_Mm01_00164669 predicted 215
5 SASI_Mm01_00164670 predicted 393
6 SASI_Mm01_00164671 predicted 282
7 SASI_Mm01_00164672 predicted 381
8 SASI_Mm01_00164673 predicted 212
9 SASI_Mm01_00164674 predicted 193
10 SASI_Mm02_00290371 predicted 304
11 SASI_Mm01_00164665 predicted 263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042419 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173726 predicted 393
2 SASI_Mm01_00173727 predicted 346
3 SASI_Mm01_00173728 predicted 312
4 SASI_Mm01_00173729 predicted 209
5 SASI_Mm01_00173730 predicted 392
6 SASI_Mm01_00173731 predicted 285
7 SASI_Mm01_00173732 predicted 383
8 SASI_Mm01_00173733 predicted 217
9 SASI_Mm01_00173734 predicted 201
10 SASI_Mm02_00290372 predicted 303
11 SASI_Mm01_00173725 predicted 266
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042420 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163992 predicted 392
2 SASI_Mm01_00163993 predicted 346
3 SASI_Mm01_00163994 predicted 311
4 SASI_Mm01_00163995 predicted 212
5 SASI_Mm01_00163996 predicted 388
6 SASI_Mm01_00163997 predicted 280
7 SASI_Mm01_00163998 predicted 376
8 SASI_Mm01_00163999 predicted 220
9 SASI_Mm01_00164000 predicted 195
10 SASI_Mm02_00290373 predicted 299
11 SASI_Mm01_00163991 predicted 268
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027687 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041717 predicted 391
2 SASI_Mm01_00041718 predicted 353
3 SASI_Mm01_00041719 predicted 310
4 SASI_Mm01_00041720 predicted 209
5 SASI_Mm01_00041721 predicted 392
6 SASI_Mm01_00041722 predicted 285
7 SASI_Mm01_00041723 predicted 376
8 SASI_Mm01_00041724 predicted 216
9 SASI_Mm01_00041725 predicted 195
10 SASI_Mm02_00332577 predicted 303
11 SASI_Mm01_00041716 predicted 268
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181731 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036718 predicted 399
2 SASI_Mm01_00036719 predicted 346
3 SASI_Mm01_00036720 predicted 305
4 SASI_Mm01_00036721 predicted 208
5 SASI_Mm01_00036722 predicted 387
6 SASI_Mm01_00036723 predicted 279
7 SASI_Mm01_00036724 predicted 380
8 SASI_Mm01_00036725 predicted 219
9 SASI_Mm01_00036726 predicted 192
10 SASI_Mm02_00349896 predicted 307
11 SASI_Mm01_00036717 predicted 263
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027687
CABYR MISSION shRNA Bacterial Glycerol Stock
calcium binding tyrosine-(Y)-phosphorylation regulated
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027687.2-604s1c1
Sequence:CCGGGCCGCTCAGATGTTAGGTAATCTCGAGATTACCTAACATCTGAGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027687.2-907s1c1
Sequence:CCGGGCCAGTCGTATATCATCCATACTCGAGTATGGATGATATACGACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027687.2-160s1c1
Sequence:CCGGCCAACAAACATCACCCAGTTTCTCGAGAAACTGGGTGATGTTTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098425    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027687.2-1573s1c1
Sequence:CCGGCCCTGTATTTACCTAATCCTACTCGAGTAGGATTAGGTAAATACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027687.2-908s1c1
Sequence:CCGGCCAGTCGTATATCATCCATATCTCGAGATATGGATGATATACGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027687
CABYR MISSION shRNA shRNA Plasmid DNA
calcium binding tyrosine-(Y)-phosphorylation regulated
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027687.2-604s1c1
Sequence:CCGGGCCGCTCAGATGTTAGGTAATCTCGAGATTACCTAACATCTGAGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027687.2-907s1c1
Sequence:CCGGGCCAGTCGTATATCATCCATACTCGAGTATGGATGATATACGACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027687.2-160s1c1
Sequence:CCGGCCAACAAACATCACCCAGTTTCTCGAGAAACTGGGTGATGTTTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098425    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027687.2-1573s1c1
Sequence:CCGGCCCTGTATTTACCTAATCCTACTCGAGTAGGATTAGGTAAATACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027687.2-908s1c1
Sequence:CCGGCCAGTCGTATATCATCCATATCTCGAGATATGGATGATATACGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027687
CABYR MISSION shRNA Lentiviral Transduction Particles
calcium binding tyrosine-(Y)-phosphorylation regulated
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027687.2-604s1c1
Sequence:CCGGGCCGCTCAGATGTTAGGTAATCTCGAGATTACCTAACATCTGAGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027687.2-907s1c1
Sequence:CCGGGCCAGTCGTATATCATCCATACTCGAGTATGGATGATATACGACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027687.2-160s1c1
Sequence:CCGGCCAACAAACATCACCCAGTTTCTCGAGAAACTGGGTGATGTTTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098425    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027687.2-1573s1c1
Sequence:CCGGCCCTGTATTTACCTAATCCTACTCGAGTAGGATTAGGTAAATACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027687.2-908s1c1
Sequence:CCGGCCAGTCGTATATCATCCATATCTCGAGATATGGATGATATACGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012189
VALIDATED
CABYR MISSION shRNA Bacterial Glycerol Stock
calcium binding tyrosine-(Y)-phosphorylation regulated
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_012189.2-508s1c1
Sequence:CCGGCCACCCAGTTTCCATCAGTTTCTCGAGAAACTGATGGAAACTGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012189.2-1310s1c1
Sequence:CCGGGCTCTCTGACACATCTTTGAACTCGAGTTCAAAGATGTGTCAGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_012189.2-681s1c1
Sequence:CCGGGCTCAGATGTTAGGTAAAGTTCTCGAGAACTTTACCTAACATCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_012189.2-240s1c1
Sequence:CCGGCCATCAAACATCAACCAGTTTCTCGAGAAACTGGTTGATGTTTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012189.2-995s1c1
Sequence:CCGGGCAGGCTGATATTGAGGTTATCTCGAGATAACCTCAATATCAGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012189.2-882s21c1
Sequence:CCGGGATTTGGGTTCTCAACCTAAACTCGAGTTTAGGTTGAGAACCCAAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012189.2-1085s21c1
Sequence:CCGGACTGCCAGAACAAATAGTTATCTCGAGATAACTATTTGTTCTGGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012189.2-298s21c1
Sequence:CCGGGGAATACTACTATGGATATAACTCGAGTTATATCCATAGTAGTATTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365494    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_012189.2-1887s21c1
Sequence:CCGGTTTATCTTAGTAGGCTCAAATCTCGAGATTTGAGCCTACTAAGATAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012189.2-1583s21c1
Sequence:CCGGAGGCCTTACTGCACCAGAAATCTCGAGATTTCTGGTGCAGTAAGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012189.2-1160s21c1
Sequence:CCGGTGAGCAGTCACCACGAGTTAGCTCGAGCTAACTCGTGGTGACTGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012189
VALIDATED
CABYR MISSION shRNA shRNA Plasmid DNA
calcium binding tyrosine-(Y)-phosphorylation regulated
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_012189.2-508s1c1
Sequence:CCGGCCACCCAGTTTCCATCAGTTTCTCGAGAAACTGATGGAAACTGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012189.2-1310s1c1
Sequence:CCGGGCTCTCTGACACATCTTTGAACTCGAGTTCAAAGATGTGTCAGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_012189.2-681s1c1
Sequence:CCGGGCTCAGATGTTAGGTAAAGTTCTCGAGAACTTTACCTAACATCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_012189.2-240s1c1
Sequence:CCGGCCATCAAACATCAACCAGTTTCTCGAGAAACTGGTTGATGTTTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012189.2-995s1c1
Sequence:CCGGGCAGGCTGATATTGAGGTTATCTCGAGATAACCTCAATATCAGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012189.2-882s21c1
Sequence:CCGGGATTTGGGTTCTCAACCTAAACTCGAGTTTAGGTTGAGAACCCAAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012189.2-1085s21c1
Sequence:CCGGACTGCCAGAACAAATAGTTATCTCGAGATAACTATTTGTTCTGGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012189.2-298s21c1
Sequence:CCGGGGAATACTACTATGGATATAACTCGAGTTATATCCATAGTAGTATTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365494    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_012189.2-1887s21c1
Sequence:CCGGTTTATCTTAGTAGGCTCAAATCTCGAGATTTGAGCCTACTAAGATAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012189.2-1583s21c1
Sequence:CCGGAGGCCTTACTGCACCAGAAATCTCGAGATTTCTGGTGCAGTAAGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012189.2-1160s21c1
Sequence:CCGGTGAGCAGTCACCACGAGTTAGCTCGAGCTAACTCGTGGTGACTGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012189
VALIDATED
CABYR MISSION shRNA Lentiviral Transduction Particles
calcium binding tyrosine-(Y)-phosphorylation regulated
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_012189.2-508s1c1
Sequence:CCGGCCACCCAGTTTCCATCAGTTTCTCGAGAAACTGATGGAAACTGGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012189.2-1310s1c1
Sequence:CCGGGCTCTCTGACACATCTTTGAACTCGAGTTCAAAGATGTGTCAGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_012189.2-681s1c1
Sequence:CCGGGCTCAGATGTTAGGTAAAGTTCTCGAGAACTTTACCTAACATCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_012189.2-240s1c1
Sequence:CCGGCCATCAAACATCAACCAGTTTCTCGAGAAACTGGTTGATGTTTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012189.2-995s1c1
Sequence:CCGGGCAGGCTGATATTGAGGTTATCTCGAGATAACCTCAATATCAGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012189.2-882s21c1
Sequence:CCGGGATTTGGGTTCTCAACCTAAACTCGAGTTTAGGTTGAGAACCCAAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012189.2-1085s21c1
Sequence:CCGGACTGCCAGAACAAATAGTTATCTCGAGATAACTATTTGTTCTGGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012189.2-298s21c1
Sequence:CCGGGGAATACTACTATGGATATAACTCGAGTTATATCCATAGTAGTATTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365494    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_012189.2-1887s21c1
Sequence:CCGGTTTATCTTAGTAGGCTCAAATCTCGAGATTTGAGCCTACTAAGATAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012189.2-1583s21c1
Sequence:CCGGAGGCCTTACTGCACCAGAAATCTCGAGATTTCTGGTGCAGTAAGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012189.2-1160s21c1
Sequence:CCGGTGAGCAGTCACCACGAGTTAGCTCGAGCTAACTCGTGGTGACTGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)