EMAIL THIS PAGE TO A FRIEND

CACNA1S

calcium channel, voltage-dependent, L type, alpha 1S subunit

83 Gene Product Result for
Synonyms: CACNL1A3 CCHL1A3 Cav1.1 HOKPP HOKPP1 MHS5 TTPP1 hypoPP
UniProtKB ID: Q13698, A4IF51, B1ALM2, Q12896, Q13934
Gene ID:
Human(779) Summary: This gene encodes one of the five subunits of the slowly inactivating L-type voltage-dependent calcium channel in skeletal muscle cells. Mutations in this gene have been associated with hypokalemic periodic paralysis, thyrotoxic periodic paralysis and malignant hyperthermia susceptibility. [provided by RefSeq, Jul 2008]
Mouse(12292) calcium channel, voltage-dependent, L type, alpha 1S subunit
Rat(682930) calcium channel, voltage-dependent, L type, alpha 1S subunit
chicken(395985) calcium channel, voltage-dependent, L type, alpha 1S subunit
domestic cat(654399) calcium channel, voltage-dependent, L type, alpha 1S subunit
cow(100337204) calcium channel, voltage-dependent, L type, alpha 1S subunit
Horse(100034092) calcium channel, voltage-dependent, L type, alpha 1S subunit
dog(490244) calcium channel, voltage-dependent, L type, alpha 1S subunit
sheep(101108767) calcium channel, voltage-dependent, L type, alpha 1S subunit
Domestic Rabbit(100009585) calcium channel, voltage-dependent, L type, alpha 1S subunit
domestic guinea pig(100734741) calcium channel, voltage-dependent, L type, alpha 1S subunit
naked mole-rat(101726232) calcium channel, voltage-dependent, L type, alpha 1S subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_484912 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_484912 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_484912 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_358335 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_358335 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_358335 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000069 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000069 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000069 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000069 Rosetta Predictions human pricing
NM_053873 Rosetta Predictions rat pricing
NM_001081023 Rosetta Predictions mouse pricing
NM_014193 Rosetta Predictions mouse pricing
XM_001002706 Rosetta Predictions mouse pricing
XM_484912 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000069 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027106 predicted 5279
2 SASI_Hs01_00027107 predicted 1993
3 SASI_Hs01_00027108 predicted 4865
4 SASI_Hs01_00027109 predicted 3933
5 SASI_Hs02_00301793 predicted 626
6 SASI_Hs01_00027110 predicted 4822
7 SASI_Hs01_00027111 predicted 4611
8 SASI_Hs01_00027112 predicted 1422
9 SASI_Hs01_00027113 predicted 519
10 SASI_Hs01_00027114 predicted 895
11 SASI_Hs01_00027115 predicted 472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053873 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266766 predicted 1932
2 SASI_Rn02_00266767 predicted 2511
3 SASI_Rn02_00266768 predicted 456
4 SASI_Rn02_00266769 predicted 3068
5 SASI_Rn02_00266770 predicted 2107
6 SASI_Rn02_00266771 predicted 1448
7 SASI_Rn02_00266772 predicted 3485
8 SASI_Rn02_00266773 predicted 463
9 SASI_Rn02_00266774 predicted 4783
10 SASI_Rn02_00266775 predicted 627
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081023 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294448 predicted 295
2 SASI_Mm02_00294449 predicted 3371
3 SASI_Mm02_00294450 predicted 1768
4 SASI_Mm02_00294451 predicted 4064
5 SASI_Mm02_00294452 predicted 5624
6 SASI_Mm02_00294453 predicted 2526
7 SASI_Mm02_00294454 predicted 2474
8 SASI_Mm02_00294455 predicted 4669
9 SASI_Mm02_00294456 predicted 4153
10 SASI_Mm02_00294457 predicted 4614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014193 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323039 predicted 298
2 SASI_Mm02_00323040 predicted 3371
3 SASI_Mm02_00323041 predicted 1767
4 SASI_Mm02_00323042 predicted 4006
5 SASI_Mm02_00323043 predicted 5554
6 SASI_Mm02_00323044 predicted 2528
7 SASI_Mm02_00323045 predicted 2478
8 SASI_Mm02_00323046 predicted 4606
9 SASI_Mm02_00323047 predicted 4092
10 SASI_Mm02_00323048 predicted 4558
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002706 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00215838 predicted 301
2 SASI_Mm01_00215839 predicted 1769
3 SASI_Mm01_00215840 predicted 294
4 SASI_Mm01_00215841 predicted 3010
5 SASI_Mm01_00215842 predicted 2541
6 SASI_Mm01_00215843 predicted 2488
7 SASI_Mm01_00215844 predicted 4156
8 SASI_Mm01_00215845 predicted 467
9 SASI_Mm01_00215846 predicted 2359
10 SASI_Mm01_00215847 predicted 328
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_484912 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00213607 predicted 884
2 SASI_Mm01_00213608 predicted 406
3 SASI_Mm01_00213609 predicted 669
4 SASI_Mm01_00213610 predicted 228
5 SASI_Mm01_00213611 predicted 1079
6 SASI_Mm01_00213612 predicted 230
7 SASI_Mm01_00213613 predicted 783
8 SASI_Mm01_00213614 predicted 898
9 SASI_Mm01_00213615 predicted 684
10 SASI_Mm01_00213616 predicted 241
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_484912
CACNA1S MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, L type, alpha 1S subunit
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_484912.1-654s1c1
Sequence:CCGGCGACCCTTATTACTCCCAGATCTCGAGATCTGGGAGTAATAAGGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484912.1-353s1c1
Sequence:CCGGAGGAACTTTGAGGAGCACGTTCTCGAGAACGTGCTCCTCAAAGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484912.1-180s1c1
Sequence:CCGGCCTCAGGACCTCACAGCAGATCTCGAGATCTGCTGTGAGGTCCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484912.1-449s1c1
Sequence:CCGGCTAGACTCCTTAGCAGCAGATCTCGAGATCTGCTGCTAAGGAGTCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484912.1-545s1c1
Sequence:CCGGGCAACAGAGCTACTGAAGCAACTCGAGTTGCTTCAGTAGCTCTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_484912
CACNA1S MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, L type, alpha 1S subunit
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_484912.1-654s1c1
Sequence:CCGGCGACCCTTATTACTCCCAGATCTCGAGATCTGGGAGTAATAAGGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484912.1-353s1c1
Sequence:CCGGAGGAACTTTGAGGAGCACGTTCTCGAGAACGTGCTCCTCAAAGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484912.1-180s1c1
Sequence:CCGGCCTCAGGACCTCACAGCAGATCTCGAGATCTGCTGTGAGGTCCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484912.1-449s1c1
Sequence:CCGGCTAGACTCCTTAGCAGCAGATCTCGAGATCTGCTGCTAAGGAGTCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484912.1-545s1c1
Sequence:CCGGGCAACAGAGCTACTGAAGCAACTCGAGTTGCTTCAGTAGCTCTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_484912
CACNA1S MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, L type, alpha 1S subunit
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_484912.1-654s1c1
Sequence:CCGGCGACCCTTATTACTCCCAGATCTCGAGATCTGGGAGTAATAAGGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484912.1-353s1c1
Sequence:CCGGAGGAACTTTGAGGAGCACGTTCTCGAGAACGTGCTCCTCAAAGTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484912.1-180s1c1
Sequence:CCGGCCTCAGGACCTCACAGCAGATCTCGAGATCTGCTGTGAGGTCCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484912.1-449s1c1
Sequence:CCGGCTAGACTCCTTAGCAGCAGATCTCGAGATCTGCTGCTAAGGAGTCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484912.1-545s1c1
Sequence:CCGGGCAACAGAGCTACTGAAGCAACTCGAGTTGCTTCAGTAGCTCTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_358335
CACNA1S MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, L type, alpha 1S subunit
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358335.1-2074s1c1
Sequence:CCGGCTCAACGTCTTCCTGGCTATTCTCGAGAATAGCCAGGAAGACGTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358335.1-4130s1c1
Sequence:CCGGCCTACTACTACTTCATCAGTTCTCGAGAACTGATGAAGTAGTAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358335.1-490s1c1
Sequence:CCGGCTGGACTTCATCATTGTCTTTCTCGAGAAAGACAATGATGAAGTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358335.1-3081s1c1
Sequence:CCGGCCAGTGGATACACAATGACTTCTCGAGAAGTCATTGTGTATCCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358335.1-3579s1c1
Sequence:CCGGCGTGGCTTTCACCATCATCTTCTCGAGAAGATGATGGTGAAAGCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_358335
CACNA1S MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, L type, alpha 1S subunit
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358335.1-2074s1c1
Sequence:CCGGCTCAACGTCTTCCTGGCTATTCTCGAGAATAGCCAGGAAGACGTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358335.1-4130s1c1
Sequence:CCGGCCTACTACTACTTCATCAGTTCTCGAGAACTGATGAAGTAGTAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358335.1-490s1c1
Sequence:CCGGCTGGACTTCATCATTGTCTTTCTCGAGAAAGACAATGATGAAGTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358335.1-3081s1c1
Sequence:CCGGCCAGTGGATACACAATGACTTCTCGAGAAGTCATTGTGTATCCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358335.1-3579s1c1
Sequence:CCGGCGTGGCTTTCACCATCATCTTCTCGAGAAGATGATGGTGAAAGCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_358335
CACNA1S MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, L type, alpha 1S subunit
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358335.1-2074s1c1
Sequence:CCGGCTCAACGTCTTCCTGGCTATTCTCGAGAATAGCCAGGAAGACGTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358335.1-4130s1c1
Sequence:CCGGCCTACTACTACTTCATCAGTTCTCGAGAACTGATGAAGTAGTAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358335.1-490s1c1
Sequence:CCGGCTGGACTTCATCATTGTCTTTCTCGAGAAAGACAATGATGAAGTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358335.1-3081s1c1
Sequence:CCGGCCAGTGGATACACAATGACTTCTCGAGAAGTCATTGTGTATCCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358335.1-3579s1c1
Sequence:CCGGCGTGGCTTTCACCATCATCTTCTCGAGAAGATGATGGTGAAAGCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000069
CACNA1S MISSION shRNA Bacterial Glycerol Stock
calcium channel, voltage-dependent, L type, alpha 1S subunit
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000069.1-902s1c1
Sequence:CCGGGCTACTTCATTGGTACAGATACTCGAGTATCTGTACCAATGAAGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000069.1-5247s1c1
Sequence:CCGGCCATAGCAACAGCCATGTGTTCTCGAGAACACATGGCTGTTGCTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000069.1-528s1c1
Sequence:CCGGCGCCATGAAGATCATTGCCTACTCGAGTAGGCAATGATCTTCATGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000069.1-2692s1c1
Sequence:CCGGCGGGCTGATTCCATGAGAAATCTCGAGATTTCTCATGGAATCAGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000069.1-1689s1c1
Sequence:CCGGGCGCCAGTACTTCATGTCTATCTCGAGATAGACATGAAGTACTGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000069.2-2808s21c1
Sequence:CCGGGGTTCCTTCTGCCGCAATTACCTCGAGGTAATTGCGGCAGAAGGAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000069.2-1147s21c1
Sequence:CCGGATGAGTGGCCCTGGATCTATTCTCGAGAATAGATCCAGGGCCACTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000069.2-2391s21c1
Sequence:CCGGATCGATGAGTTTGAATCTAATCTCGAGATTAGATTCAAACTCATCGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000069.2-4838s21c1
Sequence:CCGGGAAACGCCAAGAGGAGTATTACTCGAGTAATACTCCTCTTGGCGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000069
CACNA1S MISSION shRNA shRNA Plasmid DNA
calcium channel, voltage-dependent, L type, alpha 1S subunit
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000069.1-902s1c1
Sequence:CCGGGCTACTTCATTGGTACAGATACTCGAGTATCTGTACCAATGAAGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000069.1-5247s1c1
Sequence:CCGGCCATAGCAACAGCCATGTGTTCTCGAGAACACATGGCTGTTGCTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000069.1-528s1c1
Sequence:CCGGCGCCATGAAGATCATTGCCTACTCGAGTAGGCAATGATCTTCATGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000069.1-2692s1c1
Sequence:CCGGCGGGCTGATTCCATGAGAAATCTCGAGATTTCTCATGGAATCAGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000069.1-1689s1c1
Sequence:CCGGGCGCCAGTACTTCATGTCTATCTCGAGATAGACATGAAGTACTGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000069.2-2808s21c1
Sequence:CCGGGGTTCCTTCTGCCGCAATTACCTCGAGGTAATTGCGGCAGAAGGAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000069.2-1147s21c1
Sequence:CCGGATGAGTGGCCCTGGATCTATTCTCGAGAATAGATCCAGGGCCACTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000069.2-2391s21c1
Sequence:CCGGATCGATGAGTTTGAATCTAATCTCGAGATTAGATTCAAACTCATCGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000069.2-4838s21c1
Sequence:CCGGGAAACGCCAAGAGGAGTATTACTCGAGTAATACTCCTCTTGGCGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000069
CACNA1S MISSION shRNA Lentiviral Transduction Particles
calcium channel, voltage-dependent, L type, alpha 1S subunit
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000069.1-902s1c1
Sequence:CCGGGCTACTTCATTGGTACAGATACTCGAGTATCTGTACCAATGAAGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000069.1-5247s1c1
Sequence:CCGGCCATAGCAACAGCCATGTGTTCTCGAGAACACATGGCTGTTGCTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000069.1-528s1c1
Sequence:CCGGCGCCATGAAGATCATTGCCTACTCGAGTAGGCAATGATCTTCATGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000069.1-2692s1c1
Sequence:CCGGCGGGCTGATTCCATGAGAAATCTCGAGATTTCTCATGGAATCAGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000069.1-1689s1c1
Sequence:CCGGGCGCCAGTACTTCATGTCTATCTCGAGATAGACATGAAGTACTGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000069.2-2808s21c1
Sequence:CCGGGGTTCCTTCTGCCGCAATTACCTCGAGGTAATTGCGGCAGAAGGAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000069.2-1147s21c1
Sequence:CCGGATGAGTGGCCCTGGATCTATTCTCGAGAATAGATCCAGGGCCACTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000069.2-2391s21c1
Sequence:CCGGATCGATGAGTTTGAATCTAATCTCGAGATTAGATTCAAACTCATCGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000069.2-4838s21c1
Sequence:CCGGGAAACGCCAAGAGGAGTATTACTCGAGTAATACTCCTCTTGGCGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)