EMAIL THIS PAGE TO A FRIEND

CALML4

calmodulin-like 4

120 Gene Product Result for
Synonyms: NY-BR-20
UniProtKB ID: Q96GE6, B4DL15, F8W6Y4, Q6N048, Q9H286
Gene ID:
Mouse(75600) calmodulin-like 4
Rat(691455) calmodulin-like 4
chicken(427515) calmodulin-like 4
cow(539277) calmodulin-like 4
Horse(100052798) calmodulin-like 4
domestic cat(101100214) calmodulin-like 4
domestic guinea pig(100730149) calmodulin-like 4
naked mole-rat(101707626) calmodulin-like 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033429 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033429 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033429 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138304 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138304 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138304 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031733 Rosetta Predictions human pricing
NM_033429 Rosetta Predictions human pricing
NM_001127575 Rosetta Predictions rat pricing
NM_001102468 Rosetta Predictions mouse pricing
NM_138304 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031733 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307785 predicted 1314
2 SASI_Hs01_00085506 predicted 924
3 SASI_Hs02_00307786 predicted 1352
4 SASI_Hs01_00085508 predicted 933
5 SASI_Hs02_00307787 predicted 1285
6 SASI_Hs02_00307788 predicted 1347
7 SASI_Hs02_00307789 predicted 1631
8 SASI_Hs02_00307790 predicted 1316
9 SASI_Hs02_00307791 predicted 875
10 SASI_Hs02_00307792 predicted 1123
11 SASI_Hs01_00085503 predicted 285
12 SASI_Hs01_00085504 predicted 205
13 SASI_Hs01_00085505 predicted 255
14 SASI_Hs01_00085507 predicted 271
15 SASI_Hs01_00085509 predicted 204
16 SASI_Hs01_00085510 predicted 201
17 SASI_Hs01_00085511 predicted 285
18 SASI_Hs01_00085512 predicted 216
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033429 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109335 predicted 1457
2 SASI_Hs02_00361327 predicted 1070
3 SASI_Hs01_00109338 predicted 1492
4 SASI_Hs02_00361328 predicted 1066
5 SASI_Hs01_00109339 predicted 1423
6 SASI_Hs01_00109340 predicted 1483
7 SASI_Hs01_00109341 predicted 1763
8 SASI_Hs01_00109342 predicted 1275
9 SASI_Hs01_00109343 predicted 1462
10 SASI_Hs02_00361329 predicted 1258
11 SASI_Hs01_00109336 predicted 949
12 SASI_Hs01_00109337 predicted 1072
13 SASI_Hs01_00109344 predicted 772
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127575 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254500 predicted 409
2 SASI_Rn02_00254501 predicted 445
3 SASI_Rn02_00254502 predicted 297
4 SASI_Rn02_00254503 predicted 646
5 SASI_Rn02_00254504 predicted 416
6 SASI_Rn02_00254505 predicted 265
7 SASI_Rn02_00254506 predicted 251
8 SASI_Rn02_00254507 predicted 388
9 SASI_Rn02_00254508 predicted 485
10 SASI_Rn02_00254509 predicted 296
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102468 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302903 predicted 459
2 SASI_Mm02_00302904 predicted 494
3 SASI_Mm02_00302905 predicted 353
4 SASI_Mm02_00302906 predicted 311
5 SASI_Mm02_00302907 predicted 369
6 SASI_Mm02_00302908 predicted 482
7 SASI_Mm02_00302909 predicted 316
8 SASI_Mm02_00302910 predicted 291
9 SASI_Mm02_00302911 predicted 332
10 SASI_Mm02_00302912 predicted 296
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138304 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188839 predicted 601
2 SASI_Mm02_00339598 predicted 639
3 SASI_Mm02_00339599 predicted 493
4 SASI_Mm02_00339600 predicted 449
5 SASI_Mm01_00188848 predicted 513
6 SASI_Mm02_00339601 predicted 621
7 SASI_Mm02_00339602 predicted 456
8 SASI_Mm02_00339603 predicted 429
9 SASI_Mm02_00339604 predicted 468
10 SASI_Mm02_00339605 predicted 438
11 SASI_Mm01_00188840 predicted 621
12 SASI_Mm01_00188841 predicted 396
13 SASI_Mm01_00188842 predicted 266
14 SASI_Mm01_00188843 predicted 409
15 SASI_Mm01_00188844 predicted 362
16 SASI_Mm01_00188845 predicted 376
17 SASI_Mm01_00188846 predicted 493
18 SASI_Mm01_00188847 predicted 220
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033429
VALIDATED
CALML4 MISSION shRNA Bacterial Glycerol Stock
calmodulin-like 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033429.2-1430s21c1
Sequence:CCGGAGACAACATTACCCAACTATACTCGAGTATAGTTGGGTAATGTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365583    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033429.2-1491s21c1
Sequence:CCGGCATGGTATGAGTAGATCTTTACTCGAGTAAAGATCTACTCATACCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033429.2-1075s21c1
Sequence:CCGGCCATTATGCACATGCAAATAACTCGAGTTATTTGCATGTGCATAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033429.2-1026s21c1
Sequence:CCGGACCCACGGGATAGACGGAAATCTCGAGATTTCCGTCTATCCCGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033429.1-885s1c1
Sequence:CCGGGAAGCAGATATCGAACCCAATCTCGAGATTGGGTTCGATATCTGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033429.1-859s1c1
Sequence:CCGGCCCAGAATGTGGATGATCTCTCTCGAGAGAGATCATCCACATTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033429.1-891s1c1
Sequence:CCGGGATATCGAACCCAATGGCAAACTCGAGTTTGCCATTGGGTTCGATATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033429.1-771s1c1
Sequence:CCGGCAGCTTGGCAGACTTTAGACTCTCGAGAGTCTAAAGTCTGCCAAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033429.1-803s1c1
Sequence:CCGGGAAAGGGAACTGAACGCGGTTCTCGAGAACCGCGTTCAGTTCCCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033429
VALIDATED
CALML4 MISSION shRNA shRNA Plasmid DNA
calmodulin-like 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033429.2-1430s21c1
Sequence:CCGGAGACAACATTACCCAACTATACTCGAGTATAGTTGGGTAATGTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365583    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033429.2-1491s21c1
Sequence:CCGGCATGGTATGAGTAGATCTTTACTCGAGTAAAGATCTACTCATACCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033429.2-1075s21c1
Sequence:CCGGCCATTATGCACATGCAAATAACTCGAGTTATTTGCATGTGCATAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033429.2-1026s21c1
Sequence:CCGGACCCACGGGATAGACGGAAATCTCGAGATTTCCGTCTATCCCGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033429.1-885s1c1
Sequence:CCGGGAAGCAGATATCGAACCCAATCTCGAGATTGGGTTCGATATCTGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033429.1-859s1c1
Sequence:CCGGCCCAGAATGTGGATGATCTCTCTCGAGAGAGATCATCCACATTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033429.1-891s1c1
Sequence:CCGGGATATCGAACCCAATGGCAAACTCGAGTTTGCCATTGGGTTCGATATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033429.1-771s1c1
Sequence:CCGGCAGCTTGGCAGACTTTAGACTCTCGAGAGTCTAAAGTCTGCCAAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033429.1-803s1c1
Sequence:CCGGGAAAGGGAACTGAACGCGGTTCTCGAGAACCGCGTTCAGTTCCCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033429
VALIDATED
CALML4 MISSION shRNA Lentiviral Transduction Particles
calmodulin-like 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033429.2-1430s21c1
Sequence:CCGGAGACAACATTACCCAACTATACTCGAGTATAGTTGGGTAATGTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365583    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033429.2-1491s21c1
Sequence:CCGGCATGGTATGAGTAGATCTTTACTCGAGTAAAGATCTACTCATACCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033429.2-1075s21c1
Sequence:CCGGCCATTATGCACATGCAAATAACTCGAGTTATTTGCATGTGCATAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033429.2-1026s21c1
Sequence:CCGGACCCACGGGATAGACGGAAATCTCGAGATTTCCGTCTATCCCGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033429.1-885s1c1
Sequence:CCGGGAAGCAGATATCGAACCCAATCTCGAGATTGGGTTCGATATCTGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033429.1-859s1c1
Sequence:CCGGCCCAGAATGTGGATGATCTCTCTCGAGAGAGATCATCCACATTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033429.1-891s1c1
Sequence:CCGGGATATCGAACCCAATGGCAAACTCGAGTTTGCCATTGGGTTCGATATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033429.1-771s1c1
Sequence:CCGGCAGCTTGGCAGACTTTAGACTCTCGAGAGTCTAAAGTCTGCCAAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033429.1-803s1c1
Sequence:CCGGGAAAGGGAACTGAACGCGGTTCTCGAGAACCGCGTTCAGTTCCCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138304
VALIDATED
CALML4 MISSION shRNA Bacterial Glycerol Stock
calmodulin-like 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_138304.2-498s21c1
Sequence:CCGGTTCCTGTGCGAGACTACTAAGCTCGAGCTTAGTAGTCTCGCACAGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_138304.2-463s21c1
Sequence:CCGGAGTGAAATATGACACGTTTATCTCGAGATAAACGTGTCATATTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335537    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_138304.2-522s21c1
Sequence:CCGGGCCAAGATCAAGAGAGCAGATCTCGAGATCTGCTCTCTTGATCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_138304.2-404s21c1
Sequence:CCGGCTCACTCACAAGGAAGTGGATCTCGAGATCCACTTCCTTGTGAGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104765    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138304.1-522s1c1
Sequence:CCGGGCCAAGATCAAGAGAGCAGATCTCGAGATCTGCTCTCTTGATCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138304.1-404s1c1
Sequence:CCGGCTCACTCACAAGGAAGTGGATCTCGAGATCCACTTCCTTGTGAGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138304.1-214s1c1
Sequence:CCGGGCAGACTCATGGGATAGACAACTCGAGTTGTCTATCCCATGAGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138304.1-460s1c1
Sequence:CCGGCCAAGTGAAATATGACACGTTCTCGAGAACGTGTCATATTTCACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138304.1-461s1c1
Sequence:CCGGCAAGTGAAATATGACACGTTTCTCGAGAAACGTGTCATATTTCACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138304
VALIDATED
CALML4 MISSION shRNA shRNA Plasmid DNA
calmodulin-like 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_138304.2-498s21c1
Sequence:CCGGTTCCTGTGCGAGACTACTAAGCTCGAGCTTAGTAGTCTCGCACAGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_138304.2-463s21c1
Sequence:CCGGAGTGAAATATGACACGTTTATCTCGAGATAAACGTGTCATATTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335537    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_138304.2-522s21c1
Sequence:CCGGGCCAAGATCAAGAGAGCAGATCTCGAGATCTGCTCTCTTGATCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_138304.2-404s21c1
Sequence:CCGGCTCACTCACAAGGAAGTGGATCTCGAGATCCACTTCCTTGTGAGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104765    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138304.1-522s1c1
Sequence:CCGGGCCAAGATCAAGAGAGCAGATCTCGAGATCTGCTCTCTTGATCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138304.1-404s1c1
Sequence:CCGGCTCACTCACAAGGAAGTGGATCTCGAGATCCACTTCCTTGTGAGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138304.1-214s1c1
Sequence:CCGGGCAGACTCATGGGATAGACAACTCGAGTTGTCTATCCCATGAGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138304.1-460s1c1
Sequence:CCGGCCAAGTGAAATATGACACGTTCTCGAGAACGTGTCATATTTCACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138304.1-461s1c1
Sequence:CCGGCAAGTGAAATATGACACGTTTCTCGAGAAACGTGTCATATTTCACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138304
VALIDATED
CALML4 MISSION shRNA Lentiviral Transduction Particles
calmodulin-like 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_138304.2-498s21c1
Sequence:CCGGTTCCTGTGCGAGACTACTAAGCTCGAGCTTAGTAGTCTCGCACAGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_138304.2-463s21c1
Sequence:CCGGAGTGAAATATGACACGTTTATCTCGAGATAAACGTGTCATATTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335537    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_138304.2-522s21c1
Sequence:CCGGGCCAAGATCAAGAGAGCAGATCTCGAGATCTGCTCTCTTGATCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_138304.2-404s21c1
Sequence:CCGGCTCACTCACAAGGAAGTGGATCTCGAGATCCACTTCCTTGTGAGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104765    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138304.1-522s1c1
Sequence:CCGGGCCAAGATCAAGAGAGCAGATCTCGAGATCTGCTCTCTTGATCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138304.1-404s1c1
Sequence:CCGGCTCACTCACAAGGAAGTGGATCTCGAGATCCACTTCCTTGTGAGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138304.1-214s1c1
Sequence:CCGGGCAGACTCATGGGATAGACAACTCGAGTTGTCTATCCCATGAGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138304.1-460s1c1
Sequence:CCGGCCAAGTGAAATATGACACGTTCTCGAGAACGTGTCATATTTCACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138304.1-461s1c1
Sequence:CCGGCAAGTGAAATATGACACGTTTCTCGAGAAACGTGTCATATTTCACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)