EMAIL THIS PAGE TO A FRIEND

CAMK4

calcium/calmodulin-dependent protein kinase IV

111 Gene Product Result for
Synonyms: CaMK IV CaMK-GR IV caMK
UniProtKB ID: Q16566, D3DSZ7
Gene ID:
Human(814) Summary: The product of this gene belongs to the serine/threonine protein kinase family, and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. This enzyme is a multifunctional serine/threonine protein kinase with limited tissue distribution, that has been implicated in transcriptional regulation in lymphocytes, neurons and male germ cells. [provided by RefSeq, Jul 2008]
Mouse(12326) calcium/calmodulin-dependent protein kinase IV
Rat(25050) calcium/calmodulin-dependent protein kinase IV
naked mole-rat(101700365) calcium/calmodulin-dependent protein kinase IV
domestic guinea pig(100723881) calcium/calmodulin-dependent protein kinase IV
sheep(101108308) calcium/calmodulin-dependent protein kinase IV
Zebrafish(550270) calcium/calmodulin-dependent protein kinase IV
chicken(723973) calcium/calmodulin-dependent protein kinase IV
cow(100337083) calcium/calmodulin-dependent protein kinase IV
domestic cat(101095400) calcium/calmodulin-dependent protein kinase IV
dog(100684140) calcium/calmodulin-dependent protein kinase IV
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
C2851 Anti-CaM Kinase IV (CaMKIV) (AY-18) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, rat, mouse
immunohistochemistry, microarray, western blot pricing
C5744 Anti-CAMK4 (31-45) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
C5869 Anti-CAMK4 (346-360) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1405552 Anti-CAMK4 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA011753 Anti-CAMK4 antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA017206 Anti-CAMK4 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AV37025 Anti-CAMK4 antibody produced in rabbit IgG fraction of antiserum mouse
western blot pricing
SAB4503233 Anti-CAMK4 antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4504122 Anti-phospho-CaMK4 (pThr196/200) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4301478 Anti-phospho-CaMK4 (pThr196/200) antibody produced in rabbit affinity isolated antibody human, mouse, rat
western blot pricing
WH0000814M1 Monoclonal Anti-CAMK4 antibody produced in mouse clone 1A3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009793 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009793 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009793 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001744 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001744 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001744 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU119241 MISSION® esiRNA esiRNA human CAMK4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001744 Rosetta Predictions human pricing
NM_012727 Rosetta Predictions rat pricing
NM_009793 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001744 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332465 predicted 1527
2 SASI_Hs01_00243051 predicted 1598
3 SASI_Hs01_00243052 predicted 593
4 SASI_Hs01_00243053 predicted 553
5 SASI_Hs01_00243055 predicted 1051
6 SASI_Hs01_00243056 predicted 762
7 SASI_Hs01_00243057 predicted 351
8 SASI_Hs01_00243058 predicted 800
9 SASI_Hs01_00243059 predicted 309
10 SASI_Hs02_00332466 predicted 493
11 SASI_Hs01_00243050 predicted 383
12 SASI_Hs01_00243054 predicted 788
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012727 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075640 predicted 665
2 SASI_Rn01_00075641 predicted 880
3 SASI_Rn02_00260071 predicted 825
4 SASI_Rn02_00260072 predicted 283
5 SASI_Rn01_00075642 predicted 592
6 SASI_Rn01_00075644 predicted 1059
7 SASI_Rn01_00075645 predicted 962
8 SASI_Rn01_00075646 predicted 1163
9 SASI_Rn01_00075647 predicted 710
10 SASI_Rn01_00075648 predicted 549
11 SASI_Rn01_00075643 predicted 813
12 SASI_Rn01_00075649 predicted 220
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009793 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053851 predicted 795
2 SASI_Mm02_00317052 predicted 413
3 SASI_Mm02_00317053 predicted 1543
4 SASI_Mm01_00053852 predicted 1252
5 SASI_Mm01_00053855 predicted 588
6 SASI_Mm01_00053856 predicted 1235
7 SASI_Mm01_00053857 predicted 1052
8 SASI_Mm02_00317054 predicted 470
9 SASI_Mm02_00317055 predicted 1035
10 SASI_Mm02_00317056 predicted 1136
11 SASI_Mm01_00053850 predicted 1237
12 SASI_Mm01_00053853 predicted 695
13 SASI_Mm01_00053854 predicted 734
14 SASI_Mm01_00053858 predicted 799
15 SASI_Mm01_00053859 predicted 783
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009793
CAMK4 MISSION shRNA Bacterial Glycerol Stock
calcium/calmodulin-dependent protein kinase IV
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009793.3-437s21c1
Sequence:CCGGTACTGGATCGACGGCTCTAACCTCGAGGTTAGAGCCGTCGATCCAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009793.3-1888s21c1
Sequence:CCGGATACCAGTTGGTAACCCTAATCTCGAGATTAGGGTTACCAACTGGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009793.3-1746s21c1
Sequence:CCGGCGATTCAGCCAGAGTACTAAGCTCGAGCTTAGTACTCTGGCTGAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009793.3-2218s21c1
Sequence:CCGGGTAGGCTGAAGATGGTTATAACTCGAGTTATAACCATCTTCAGCCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009793.1-485s1c1
Sequence:CCGGCCGTTGCTTACCTGCATGAAACTCGAGTTTCATGCAGGTAAGCAACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009793.1-1241s1c1
Sequence:CCGGTGGAGAAAGATGCAGGTGTAACTCGAGTTACACCTGCATCTTTCTCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009793.1-897s1c1
Sequence:CCGGGCTGACTACATTTCAAGCCCTCTCGAGAGGGCTTGAAATGTAGTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009793.1-765s1c1
Sequence:CCGGGCGAGGTGATCAGTTCATGTTCTCGAGAACATGAACTGATCACCTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009793.1-725s1c1
Sequence:CCGGCCTACATCCTACTTTGTGGATCTCGAGATCCACAAAGTAGGATGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009793
CAMK4 MISSION shRNA shRNA Plasmid DNA
calcium/calmodulin-dependent protein kinase IV
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009793.3-437s21c1
Sequence:CCGGTACTGGATCGACGGCTCTAACCTCGAGGTTAGAGCCGTCGATCCAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009793.3-1888s21c1
Sequence:CCGGATACCAGTTGGTAACCCTAATCTCGAGATTAGGGTTACCAACTGGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009793.3-1746s21c1
Sequence:CCGGCGATTCAGCCAGAGTACTAAGCTCGAGCTTAGTACTCTGGCTGAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009793.3-2218s21c1
Sequence:CCGGGTAGGCTGAAGATGGTTATAACTCGAGTTATAACCATCTTCAGCCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009793.1-485s1c1
Sequence:CCGGCCGTTGCTTACCTGCATGAAACTCGAGTTTCATGCAGGTAAGCAACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009793.1-1241s1c1
Sequence:CCGGTGGAGAAAGATGCAGGTGTAACTCGAGTTACACCTGCATCTTTCTCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009793.1-897s1c1
Sequence:CCGGGCTGACTACATTTCAAGCCCTCTCGAGAGGGCTTGAAATGTAGTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009793.1-765s1c1
Sequence:CCGGGCGAGGTGATCAGTTCATGTTCTCGAGAACATGAACTGATCACCTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009793.1-725s1c1
Sequence:CCGGCCTACATCCTACTTTGTGGATCTCGAGATCCACAAAGTAGGATGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009793
CAMK4 MISSION shRNA Lentiviral Transduction Particles
calcium/calmodulin-dependent protein kinase IV
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009793.3-437s21c1
Sequence:CCGGTACTGGATCGACGGCTCTAACCTCGAGGTTAGAGCCGTCGATCCAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009793.3-1888s21c1
Sequence:CCGGATACCAGTTGGTAACCCTAATCTCGAGATTAGGGTTACCAACTGGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009793.3-1746s21c1
Sequence:CCGGCGATTCAGCCAGAGTACTAAGCTCGAGCTTAGTACTCTGGCTGAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009793.3-2218s21c1
Sequence:CCGGGTAGGCTGAAGATGGTTATAACTCGAGTTATAACCATCTTCAGCCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009793.1-485s1c1
Sequence:CCGGCCGTTGCTTACCTGCATGAAACTCGAGTTTCATGCAGGTAAGCAACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009793.1-1241s1c1
Sequence:CCGGTGGAGAAAGATGCAGGTGTAACTCGAGTTACACCTGCATCTTTCTCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009793.1-897s1c1
Sequence:CCGGGCTGACTACATTTCAAGCCCTCTCGAGAGGGCTTGAAATGTAGTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009793.1-765s1c1
Sequence:CCGGGCGAGGTGATCAGTTCATGTTCTCGAGAACATGAACTGATCACCTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009793.1-725s1c1
Sequence:CCGGCCTACATCCTACTTTGTGGATCTCGAGATCCACAAAGTAGGATGTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001744
VALIDATED
CAMK4 MISSION shRNA Bacterial Glycerol Stock
calcium/calmodulin-dependent protein kinase IV
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217950    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001744.3-1900s21c1
Sequence:GTACCGGTGAACTACTGCTTAGCTAATACTCGAGTATTAGCTAAGCAGTAGTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001744.3-769s21c1
Sequence:GTACCGGCATGTGGTCTGTAGGAATAATCTCGAGATTATTCCTACAGACCACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001744.3-1503s21c1
Sequence:CCGGTGATCCTGCCAGAGTACTAAACTCGAGTTTAGTACTCTGGCAGGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001744.3-990s21c1
Sequence:CCGGATCCGTGGGTCACAGGTAAAGCTCGAGCTTTACCTGTGACCCACGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001744.3-519s21c1
Sequence:CCGGATGCTGCAGATGCCGTTAAACCTCGAGGTTTAACGGCATCTGCAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001744.3-1358s1c1
Sequence:CCGGGCAGTGGAGGATGGGATAAAGCTCGAGCTTTATCCCATCCTCCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196601    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001744.3-1901s1c1
Sequence:CCGGGAACTACTGCTTAGCTAATACCTCGAGGTATTAGCTAAGCAGTAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196662    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001744.3-471s1c1
Sequence:CCGGGAGAACTGTTTGATAGGATTGCTCGAGCAATCCTATCAAACAGTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_001744.x-354s1c1
Sequence:CCGGTCGTAAGAACTGAGATAGGAGCTCGAGCTCCTATCTCAGTTCTTACGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_001744.x-447s1c1
Sequence:CCGGTGGTCCTAGAACTCGTCACAGCTCGAGCTGTGACGAGTTCTAGGACCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_001744.x-384s1c1
Sequence:CCGGGCCTCTCACATCCAAACATTACTCGAGTAATGTTTGGATGTGAGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001744.x-954s1c1
Sequence:CCGGCAAAGAAACGGCTGACTACATCTCGAGATGTAGTCAGCCGTTTCTTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001744.x-501s1c1
Sequence:CCGGGATATTACAGTGAGCGAGATGCTCGAGCATCTCGCTCACTGTAATATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_001744.x-1302s1c1
Sequence:CCGGAGAAAGTTAAAGGTGCAGATACTCGAGTATCTGCACCTTTAACTTTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_001744.x-1195s1c1
Sequence:CCGGCAACGAGGACATGAAAGCTATCTCGAGATAGCTTTCATGTCCTCGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001744.x-998s1c1
Sequence:CCGGGTCACAGGTAAAGCAGCCAATCTCGAGATTGGCTGCTTTACCTGTGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001744
VALIDATED
CAMK4 MISSION shRNA shRNA Plasmid DNA
calcium/calmodulin-dependent protein kinase IV
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217950    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001744.3-1900s21c1
Sequence:GTACCGGTGAACTACTGCTTAGCTAATACTCGAGTATTAGCTAAGCAGTAGTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001744.3-769s21c1
Sequence:GTACCGGCATGTGGTCTGTAGGAATAATCTCGAGATTATTCCTACAGACCACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001744.3-1503s21c1
Sequence:CCGGTGATCCTGCCAGAGTACTAAACTCGAGTTTAGTACTCTGGCAGGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001744.3-990s21c1
Sequence:CCGGATCCGTGGGTCACAGGTAAAGCTCGAGCTTTACCTGTGACCCACGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001744.3-519s21c1
Sequence:CCGGATGCTGCAGATGCCGTTAAACCTCGAGGTTTAACGGCATCTGCAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001744.3-1358s1c1
Sequence:CCGGGCAGTGGAGGATGGGATAAAGCTCGAGCTTTATCCCATCCTCCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196601    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001744.3-1901s1c1
Sequence:CCGGGAACTACTGCTTAGCTAATACCTCGAGGTATTAGCTAAGCAGTAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196662    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001744.3-471s1c1
Sequence:CCGGGAGAACTGTTTGATAGGATTGCTCGAGCAATCCTATCAAACAGTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_001744.x-354s1c1
Sequence:CCGGTCGTAAGAACTGAGATAGGAGCTCGAGCTCCTATCTCAGTTCTTACGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_001744.x-447s1c1
Sequence:CCGGTGGTCCTAGAACTCGTCACAGCTCGAGCTGTGACGAGTTCTAGGACCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_001744.x-384s1c1
Sequence:CCGGGCCTCTCACATCCAAACATTACTCGAGTAATGTTTGGATGTGAGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001744.x-954s1c1
Sequence:CCGGCAAAGAAACGGCTGACTACATCTCGAGATGTAGTCAGCCGTTTCTTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001744.x-501s1c1
Sequence:CCGGGATATTACAGTGAGCGAGATGCTCGAGCATCTCGCTCACTGTAATATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_001744.x-1302s1c1
Sequence:CCGGAGAAAGTTAAAGGTGCAGATACTCGAGTATCTGCACCTTTAACTTTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_001744.x-1195s1c1
Sequence:CCGGCAACGAGGACATGAAAGCTATCTCGAGATAGCTTTCATGTCCTCGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001744.x-998s1c1
Sequence:CCGGGTCACAGGTAAAGCAGCCAATCTCGAGATTGGCTGCTTTACCTGTGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001744
VALIDATED
CAMK4 MISSION shRNA Lentiviral Transduction Particles
calcium/calmodulin-dependent protein kinase IV
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217950    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001744.3-1900s21c1
Sequence:GTACCGGTGAACTACTGCTTAGCTAATACTCGAGTATTAGCTAAGCAGTAGTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001744.3-769s21c1
Sequence:GTACCGGCATGTGGTCTGTAGGAATAATCTCGAGATTATTCCTACAGACCACATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001744.3-1503s21c1
Sequence:CCGGTGATCCTGCCAGAGTACTAAACTCGAGTTTAGTACTCTGGCAGGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001744.3-990s21c1
Sequence:CCGGATCCGTGGGTCACAGGTAAAGCTCGAGCTTTACCTGTGACCCACGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001744.3-519s21c1
Sequence:CCGGATGCTGCAGATGCCGTTAAACCTCGAGGTTTAACGGCATCTGCAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001744.3-1358s1c1
Sequence:CCGGGCAGTGGAGGATGGGATAAAGCTCGAGCTTTATCCCATCCTCCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196601    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001744.3-1901s1c1
Sequence:CCGGGAACTACTGCTTAGCTAATACCTCGAGGTATTAGCTAAGCAGTAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196662    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001744.3-471s1c1
Sequence:CCGGGAGAACTGTTTGATAGGATTGCTCGAGCAATCCTATCAAACAGTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_001744.x-354s1c1
Sequence:CCGGTCGTAAGAACTGAGATAGGAGCTCGAGCTCCTATCTCAGTTCTTACGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_001744.x-447s1c1
Sequence:CCGGTGGTCCTAGAACTCGTCACAGCTCGAGCTGTGACGAGTTCTAGGACCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_001744.x-384s1c1
Sequence:CCGGGCCTCTCACATCCAAACATTACTCGAGTAATGTTTGGATGTGAGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001744.x-954s1c1
Sequence:CCGGCAAAGAAACGGCTGACTACATCTCGAGATGTAGTCAGCCGTTTCTTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001744.x-501s1c1
Sequence:CCGGGATATTACAGTGAGCGAGATGCTCGAGCATCTCGCTCACTGTAATATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_001744.x-1302s1c1
Sequence:CCGGAGAAAGTTAAAGGTGCAGATACTCGAGTATCTGCACCTTTAACTTTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_001744.x-1195s1c1
Sequence:CCGGCAACGAGGACATGAAAGCTATCTCGAGATAGCTTTCATGTCCTCGTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001744.x-998s1c1
Sequence:CCGGGTCACAGGTAAAGCAGCCAATCTCGAGATTGGCTGCTTTACCTGTGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)