EMAIL THIS PAGE TO A FRIEND

CAP2

CAP, adenylate cyclase-associated protein, 2 (yeast)

82 Gene Product Result for
UniProtKB ID: P40123, B2R5Y3, Q6IAY2
Gene ID:
Human(10486) Summary: This gene was identified by its similarity to the gene for human adenylyl cyclase-associated protein. The function of the protein encoded by this gene is unknown. However, the protein appears to be able to interact with adenylyl cyclase-associated protein and actin. [provided by RefSeq, Jul 2008]
Mouse(67252) CAP, adenylate cyclase-associated protein, 2 (yeast)
Rat(116653) CAP, adenylate cyclase-associated protein, 2 (yeast)
Zebrafish(393809) CAP, adenylate cyclase-associated protein, 2 (yeast)
cow(515190) CAP, adenylate cyclase-associated protein, 2 (yeast)
Horse(100052005) CAP, adenylate cyclase-associated protein, 2 (yeast)
domestic cat(101100390) CAP, adenylate cyclase-associated protein, 2 (yeast)
dog(478731) CAP, adenylate cyclase-associated protein, 2 (yeast)
chicken(420847) CAP, adenylate cyclase-associated protein, 2 (yeast)
sheep(101102097) CAP, adenylate cyclase-associated protein, 2 (yeast)
Domestic Rabbit(100342083) CAP, adenylate cyclase-associated protein, 2 (yeast)
domestic guinea pig(100720702) CAP, adenylate cyclase-associated protein, 2 (yeast)
naked mole-rat(101708066) CAP, adenylate cyclase-associated protein, 2 (yeast)
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006366 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006366 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006366 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026056 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026056 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026056 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006366 Rosetta Predictions human pricing
NM_053874 Rosetta Predictions rat pricing
NM_026056 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006366 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150905 predicted 1436
2 SASI_Hs01_00150906 predicted 762
3 SASI_Hs01_00150907 predicted 1420
4 SASI_Hs01_00150908 predicted 1525
5 SASI_Hs01_00150909 predicted 1542
6 SASI_Hs01_00150910 predicted 396
7 SASI_Hs01_00150911 predicted 1256
8 SASI_Hs01_00150912 predicted 400
9 SASI_Hs01_00150913 predicted 808
10 SASI_Hs02_00341427 predicted 1356
11 SASI_Hs01_00150914 predicted 509
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053874 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089266 predicted 1126
2 SASI_Rn01_00089267 predicted 401
3 SASI_Rn01_00089268 predicted 1334
4 SASI_Rn01_00089269 predicted 1383
5 SASI_Rn01_00089270 predicted 208
6 SASI_Rn02_00266776 predicted 1014
7 SASI_Rn01_00089272 predicted 1265
8 SASI_Rn01_00089273 predicted 495
9 SASI_Rn01_00089274 predicted 1404
10 SASI_Rn01_00089275 predicted 429
11 SASI_Rn01_00089271 predicted 1350
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026056 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329580 predicted 1182
2 SASI_Mm01_00055524 predicted 1545
3 SASI_Mm02_00329581 predicted 1108
4 SASI_Mm01_00055525 predicted 1250
5 SASI_Mm01_00055526 predicted 1345
6 SASI_Mm01_00055527 predicted 226
7 SASI_Mm01_00055528 predicted 1498
8 SASI_Mm01_00055529 predicted 1003
9 SASI_Mm01_00055531 predicted 1287
10 SASI_Mm01_00055532 predicted 436
11 SASI_Mm01_00055523 predicted 1244
12 SASI_Mm01_00055530 predicted 1115
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006366
CAP2 MISSION shRNA Bacterial Glycerol Stock
CAP, adenylate cyclase-associated protein, 2 (yeast)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006366.2-1628s21c1
Sequence:CCGGCATGGGATGGATCCAAGTTAACTCGAGTTAACTTGGATCCATCCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006366.2-1542s1c2
Sequence:CCGGGAGCGCCAAGTCATCTGAAATCTCGAGATTTCAGATGACTTGGCGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006366.2-1428s21c1
Sequence:CCGGCAACTCCCAGGACATTCAAATCTCGAGATTTGAATGTCCTGGGAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006366.2-2043s1c1
Sequence:CCGGCCTTTGAGAATCTAAGATGTACTCGAGTACATCTTAGATTCTCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006366.2-1021s1c1
Sequence:CCGGCGCTCAGCTTTATTTGCCCAACTCGAGTTGGGCAAATAAAGCTGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006366.2-594s1c1
Sequence:CCGGCCAAACTTTCAGAGAGAGAAACTCGAGTTTCTCTCTCTGAAAGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006366.2-1180s1c1
Sequence:CCGGCCTAAATCTTATCCTTCTCAACTCGAGTTGAGAAGGATAAGATTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006366
CAP2 MISSION shRNA shRNA Plasmid DNA
CAP, adenylate cyclase-associated protein, 2 (yeast)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006366.2-1628s21c1
Sequence:CCGGCATGGGATGGATCCAAGTTAACTCGAGTTAACTTGGATCCATCCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006366.2-1542s1c2
Sequence:CCGGGAGCGCCAAGTCATCTGAAATCTCGAGATTTCAGATGACTTGGCGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006366.2-1428s21c1
Sequence:CCGGCAACTCCCAGGACATTCAAATCTCGAGATTTGAATGTCCTGGGAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006366.2-2043s1c1
Sequence:CCGGCCTTTGAGAATCTAAGATGTACTCGAGTACATCTTAGATTCTCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006366.2-1021s1c1
Sequence:CCGGCGCTCAGCTTTATTTGCCCAACTCGAGTTGGGCAAATAAAGCTGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006366.2-594s1c1
Sequence:CCGGCCAAACTTTCAGAGAGAGAAACTCGAGTTTCTCTCTCTGAAAGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006366.2-1180s1c1
Sequence:CCGGCCTAAATCTTATCCTTCTCAACTCGAGTTGAGAAGGATAAGATTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006366
CAP2 MISSION shRNA Lentiviral Transduction Particles
CAP, adenylate cyclase-associated protein, 2 (yeast)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006366.2-1628s21c1
Sequence:CCGGCATGGGATGGATCCAAGTTAACTCGAGTTAACTTGGATCCATCCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006366.2-1542s1c2
Sequence:CCGGGAGCGCCAAGTCATCTGAAATCTCGAGATTTCAGATGACTTGGCGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006366.2-1428s21c1
Sequence:CCGGCAACTCCCAGGACATTCAAATCTCGAGATTTGAATGTCCTGGGAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006366.2-2043s1c1
Sequence:CCGGCCTTTGAGAATCTAAGATGTACTCGAGTACATCTTAGATTCTCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006366.2-1021s1c1
Sequence:CCGGCGCTCAGCTTTATTTGCCCAACTCGAGTTGGGCAAATAAAGCTGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006366.2-594s1c1
Sequence:CCGGCCAAACTTTCAGAGAGAGAAACTCGAGTTTCTCTCTCTGAAAGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006366.2-1180s1c1
Sequence:CCGGCCTAAATCTTATCCTTCTCAACTCGAGTTGAGAAGGATAAGATTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026056
CAP2 MISSION shRNA Bacterial Glycerol Stock
CAP, adenylate cyclase-associated protein, 2 (yeast)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105905    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026056.2-1902s1c1
Sequence:CCGGCCCTAAAGAATAAGGCTCTATCTCGAGATAGAGCCTTATTCTTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026056.2-387s1c1
Sequence:CCGGGAAGCCCATATCGGAGAAGATCTCGAGATCTTCTCCGATATGGGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026056.2-1298s1c1
Sequence:CCGGCCATTAATAAGACAGAAGGATCTCGAGATCCTTCTGTCTTATTAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026056.2-276s1c1
Sequence:CCGGCGTAGAGACTCACGCAGAAATCTCGAGATTTCTGCGTGAGTCTCTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026056.2-1429s1c1
Sequence:CCGGCCCGAGCAGTTCAAGACAATACTCGAGTATTGTCTTGAACTGCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026056
CAP2 MISSION shRNA shRNA Plasmid DNA
CAP, adenylate cyclase-associated protein, 2 (yeast)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105905    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026056.2-1902s1c1
Sequence:CCGGCCCTAAAGAATAAGGCTCTATCTCGAGATAGAGCCTTATTCTTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026056.2-387s1c1
Sequence:CCGGGAAGCCCATATCGGAGAAGATCTCGAGATCTTCTCCGATATGGGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026056.2-1298s1c1
Sequence:CCGGCCATTAATAAGACAGAAGGATCTCGAGATCCTTCTGTCTTATTAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026056.2-276s1c1
Sequence:CCGGCGTAGAGACTCACGCAGAAATCTCGAGATTTCTGCGTGAGTCTCTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026056.2-1429s1c1
Sequence:CCGGCCCGAGCAGTTCAAGACAATACTCGAGTATTGTCTTGAACTGCTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026056
CAP2 MISSION shRNA Lentiviral Transduction Particles
CAP, adenylate cyclase-associated protein, 2 (yeast)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105905    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026056.2-1902s1c1
Sequence:CCGGCCCTAAAGAATAAGGCTCTATCTCGAGATAGAGCCTTATTCTTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026056.2-387s1c1
Sequence:CCGGGAAGCCCATATCGGAGAAGATCTCGAGATCTTCTCCGATATGGGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026056.2-1298s1c1
Sequence:CCGGCCATTAATAAGACAGAAGGATCTCGAGATCCTTCTGTCTTATTAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026056.2-276s1c1
Sequence:CCGGCGTAGAGACTCACGCAGAAATCTCGAGATTTCTGCGTGAGTCTCTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026056.2-1429s1c1
Sequence:CCGGCCCGAGCAGTTCAAGACAATACTCGAGTATTGTCTTGAACTGCTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)