EMAIL THIS PAGE TO A FRIEND

CAPNS1

calpain, small subunit 1

107 Gene Product Result for
Synonyms: 30K CALPAIN4 CANP CANPS CAPN4 CDPS CSS1
UniProtKB ID: P04632, A8K0P1, Q8WTX3, Q96EW0
Gene ID:
Human(826) Summary: Calpains are a ubiquitous, well-conserved family of calcium-dependent, cysteine proteases. Calpain families have been implicated in neurodegenerative processes, as their activation can be triggered by calcium influx and oxidative stress. Calpain I and II are heterodimeric with distinct large subunits associated with common small subunits, all of which are encoded by different genes. This gene encodes a small subunit common to both calpain I and II and is associated with myotonic dystrophy. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(12336) calpain, small subunit 1
Rat(29156) calpain, small subunit 1
dog(611746) calpain, small subunit 1
domestic cat(101099260) calpain, small subunit 1
cow(281664) calpain, small subunit 1
sheep(678676) calpain, small subunit 1
Domestic Rabbit(100009090) calpain, small subunit 1
naked mole-rat(101714330) calpain, small subunit 1
domestic guinea pig(100728039) calpain, small subunit 1
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009795 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009795 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009795 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001749 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001749 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001749 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003962 Rosetta Predictions human pricing
NM_001749 Rosetta Predictions human pricing
NM_017118 Rosetta Predictions rat pricing
NM_009795 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003962 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166164 predicted 876
2 SASI_Hs01_00166165 predicted 870
3 SASI_Hs01_00166166 predicted 902
4 SASI_Hs01_00166167 predicted 581
5 SASI_Hs01_00166168 predicted 768
6 SASI_Hs01_00166169 predicted 689
7 SASI_Hs01_00166171 predicted 760
8 SASI_Hs01_00166172 predicted 710
9 SASI_Hs01_00166173 predicted 932
10 SASI_Hs02_00304433 predicted 620
11 SASI_Hs01_00166170 predicted 864
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001749 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206564 predicted 874
2 SASI_Hs01_00206565 predicted 874
3 SASI_Hs01_00206566 predicted 899
4 SASI_Hs01_00206567 predicted 592
5 SASI_Hs01_00206568 predicted 768
6 SASI_Hs01_00206569 predicted 691
7 SASI_Hs01_00206571 predicted 761
8 SASI_Hs01_00206572 predicted 711
9 SASI_Hs01_00206573 predicted 939
10 SASI_Hs02_00332469 predicted 617
11 SASI_Hs01_00206570 predicted 875
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017118 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095077 predicted 782
2 SASI_Rn01_00095078 predicted 912
3 SASI_Rn01_00095079 predicted 617
4 SASI_Rn01_00095080 predicted 774
5 SASI_Rn01_00095081 predicted 580
6 SASI_Rn01_00095082 predicted 462
7 SASI_Rn02_00261357 predicted 764
8 SASI_Rn01_00095083 predicted 1062
9 SASI_Rn01_00095084 predicted 690
10 SASI_Rn01_00095085 predicted 475
11 SASI_Rn01_00095086 predicted 616
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009795 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317058 predicted 715
2 SASI_Mm02_00317059 predicted 657
3 SASI_Mm01_00127701 predicted 1070
4 SASI_Mm02_00317060 predicted 341
5 SASI_Mm01_00127703 predicted 962
6 SASI_Mm01_00127704 predicted 915
7 SASI_Mm01_00127705 predicted 571
8 SASI_Mm01_00127706 predicted 610
9 SASI_Mm01_00127708 predicted 885
10 SASI_Mm02_00317061 predicted 1105
11 SASI_Mm01_00127699 predicted 623
12 SASI_Mm01_00127700 predicted 689
13 SASI_Mm01_00127702 predicted 699
14 SASI_Mm01_00127707 predicted 829
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009795
VALIDATED
CAPNS1 MISSION shRNA Bacterial Glycerol Stock
calpain, small subunit 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009795.3-298s21c1
Sequence:CCGGTCCGCCTCCACGTAGTCATTACTCGAGTAATGACTACGTGGAGGCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009795.3-405s21c1
Sequence:CCGGGCGCCACAGAACTCATGAATACTCGAGTATTCATGAGTTCTGTGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009795.3-721s21c1
Sequence:CCGGCGGGAACATGGATTTCGATAACTCGAGTTATCGAAATCCATGTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009795.3-605s21c1
Sequence:CCGGACTGACCGATCAGGGACTATCCTCGAGGATAGTCCCTGATCGGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374886    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009795.3-1218s21c1
Sequence:CCGGTGTCCCTACACACCCTGTTACCTCGAGGTAACAGGGTGTGTAGGGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009795.3-922s21c1
Sequence:CCGGATCCTGACTGCAGCCGCATTTCTCGAGAAATGCGGCTGCAGTCAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009795.1-1168s1c1
Sequence:CCGGCTGTCTTAGTTCTGGGAGGATCTCGAGATCCTCCCAGAACTAAGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009795.1-284s1c1
Sequence:CCGGCCACGTAGTCATTACTCTAATCTCGAGATTAGAGTAATGACTACGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009795.1-699s1c1
Sequence:CCGGGCGGAAACATGGATTTCGATACTCGAGTATCGAAATCCATGTTTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009795.1-559s1c1
Sequence:CCGGGCAGGCTATATACAAACGCTTCTCGAGAAGCGTTTGTATATAGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009795.1-761s1c1
Sequence:CCGGGCTTTCAAATCTCTTGACAAACTCGAGTTTGTCAAGAGATTTGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009795
VALIDATED
CAPNS1 MISSION shRNA shRNA Plasmid DNA
calpain, small subunit 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009795.3-298s21c1
Sequence:CCGGTCCGCCTCCACGTAGTCATTACTCGAGTAATGACTACGTGGAGGCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009795.3-405s21c1
Sequence:CCGGGCGCCACAGAACTCATGAATACTCGAGTATTCATGAGTTCTGTGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009795.3-721s21c1
Sequence:CCGGCGGGAACATGGATTTCGATAACTCGAGTTATCGAAATCCATGTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009795.3-605s21c1
Sequence:CCGGACTGACCGATCAGGGACTATCCTCGAGGATAGTCCCTGATCGGTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374886    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009795.3-1218s21c1
Sequence:CCGGTGTCCCTACACACCCTGTTACCTCGAGGTAACAGGGTGTGTAGGGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009795.3-922s21c1
Sequence:CCGGATCCTGACTGCAGCCGCATTTCTCGAGAAATGCGGCTGCAGTCAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009795.1-1168s1c1
Sequence:CCGGCTGTCTTAGTTCTGGGAGGATCTCGAGATCCTCCCAGAACTAAGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009795.1-284s1c1
Sequence:CCGGCCACGTAGTCATTACTCTAATCTCGAGATTAGAGTAATGACTACGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009795.1-699s1c1
Sequence:CCGGGCGGAAACATGGATTTCGATACTCGAGTATCGAAATCCATGTTTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009795.1-559s1c1
Sequence:CCGGGCAGGCTATATACAAACGCTTCTCGAGAAGCGTTTGTATATAGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009795.1-761s1c1
Sequence:CCGGGCTTTCAAATCTCTTGACAAACTCGAGTTTGTCAAGAGATTTGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009795
VALIDATED
CAPNS1 MISSION shRNA Lentiviral Transduction Particles
calpain, small subunit 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009795.3-298s21c1
Sequence:CCGGTCCGCCTCCACGTAGTCATTACTCGAGTAATGACTACGTGGAGGCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009795.3-405s21c1
Sequence:CCGGGCGCCACAGAACTCATGAATACTCGAGTATTCATGAGTTCTGTGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009795.3-721s21c1
Sequence:CCGGCGGGAACATGGATTTCGATAACTCGAGTTATCGAAATCCATGTTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009795.3-605s21c1
Sequence:CCGGACTGACCGATCAGGGACTATCCTCGAGGATAGTCCCTGATCGGTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374886    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009795.3-1218s21c1
Sequence:CCGGTGTCCCTACACACCCTGTTACCTCGAGGTAACAGGGTGTGTAGGGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009795.3-922s21c1
Sequence:CCGGATCCTGACTGCAGCCGCATTTCTCGAGAAATGCGGCTGCAGTCAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009795.1-1168s1c1
Sequence:CCGGCTGTCTTAGTTCTGGGAGGATCTCGAGATCCTCCCAGAACTAAGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009795.1-284s1c1
Sequence:CCGGCCACGTAGTCATTACTCTAATCTCGAGATTAGAGTAATGACTACGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009795.1-699s1c1
Sequence:CCGGGCGGAAACATGGATTTCGATACTCGAGTATCGAAATCCATGTTTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009795.1-559s1c1
Sequence:CCGGGCAGGCTATATACAAACGCTTCTCGAGAAGCGTTTGTATATAGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009795.1-761s1c1
Sequence:CCGGGCTTTCAAATCTCTTGACAAACTCGAGTTTGTCAAGAGATTTGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001749
CAPNS1 MISSION shRNA Bacterial Glycerol Stock
calpain, small subunit 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001749.2-505s21c1
Sequence:CCGGCGCCACAGAACTCATGAACATCTCGAGATGTTCATGAGTTCTGTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001749.2-870s21c1
Sequence:CCGGCCATGTTCCGTGCCTTCAAATCTCGAGATTTGAAGGCACGGAACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001749.2-679s21c1
Sequence:CCGGGCAGGCCATATACAAACAGTTCTCGAGAACTGTTTGTATATGGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001749.2-407s21c1
Sequence:CCGGCGCACACATTACTCCAACATTCTCGAGAATGTTGGAGTAATGTGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001749.x-408s1c1
Sequence:CCGGCGCACACATTACTCCAACATTCTCGAGAATGTTGGAGTAATGTGTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001749.x-506s1c1
Sequence:CCGGCGCCACAGAACTCATGAACATCTCGAGATGTTCATGAGTTCTGTGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001749.x-680s1c1
Sequence:CCGGGCAGGCCATATACAAACAGTTCTCGAGAACTGTTTGTATATGGCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001749.x-871s1c1
Sequence:CCGGCCATGTTCCGTGCCTTCAAATCTCGAGATTTGAAGGCACGGAACATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003546    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001749.x-1114s1c1
Sequence:CCGGCTTCTCAACATCCAGGGCCCACTCGAGTGGGCCCTGGATGTTGAGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001749
CAPNS1 MISSION shRNA shRNA Plasmid DNA
calpain, small subunit 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001749.2-505s21c1
Sequence:CCGGCGCCACAGAACTCATGAACATCTCGAGATGTTCATGAGTTCTGTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001749.2-870s21c1
Sequence:CCGGCCATGTTCCGTGCCTTCAAATCTCGAGATTTGAAGGCACGGAACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001749.2-679s21c1
Sequence:CCGGGCAGGCCATATACAAACAGTTCTCGAGAACTGTTTGTATATGGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001749.2-407s21c1
Sequence:CCGGCGCACACATTACTCCAACATTCTCGAGAATGTTGGAGTAATGTGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001749.x-408s1c1
Sequence:CCGGCGCACACATTACTCCAACATTCTCGAGAATGTTGGAGTAATGTGTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001749.x-506s1c1
Sequence:CCGGCGCCACAGAACTCATGAACATCTCGAGATGTTCATGAGTTCTGTGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001749.x-680s1c1
Sequence:CCGGGCAGGCCATATACAAACAGTTCTCGAGAACTGTTTGTATATGGCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001749.x-871s1c1
Sequence:CCGGCCATGTTCCGTGCCTTCAAATCTCGAGATTTGAAGGCACGGAACATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003546    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001749.x-1114s1c1
Sequence:CCGGCTTCTCAACATCCAGGGCCCACTCGAGTGGGCCCTGGATGTTGAGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001749
CAPNS1 MISSION shRNA Lentiviral Transduction Particles
calpain, small subunit 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001749.2-505s21c1
Sequence:CCGGCGCCACAGAACTCATGAACATCTCGAGATGTTCATGAGTTCTGTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001749.2-870s21c1
Sequence:CCGGCCATGTTCCGTGCCTTCAAATCTCGAGATTTGAAGGCACGGAACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001749.2-679s21c1
Sequence:CCGGGCAGGCCATATACAAACAGTTCTCGAGAACTGTTTGTATATGGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001749.2-407s21c1
Sequence:CCGGCGCACACATTACTCCAACATTCTCGAGAATGTTGGAGTAATGTGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001749.x-408s1c1
Sequence:CCGGCGCACACATTACTCCAACATTCTCGAGAATGTTGGAGTAATGTGTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001749.x-506s1c1
Sequence:CCGGCGCCACAGAACTCATGAACATCTCGAGATGTTCATGAGTTCTGTGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001749.x-680s1c1
Sequence:CCGGGCAGGCCATATACAAACAGTTCTCGAGAACTGTTTGTATATGGCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001749.x-871s1c1
Sequence:CCGGCCATGTTCCGTGCCTTCAAATCTCGAGATTTGAAGGCACGGAACATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003546    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001749.x-1114s1c1
Sequence:CCGGCTTCTCAACATCCAGGGCCCACTCGAGTGGGCCCTGGATGTTGAGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)