EMAIL THIS PAGE TO A FRIEND

CARD14

caspase recruitment domain family, member 14

67 Gene Product Result for
Synonyms: BIMP2 CARMA2 PRP PSORS2 PSS1
UniProtKB ID: Q9BXL6, B8QQJ3, Q9BVB5
Gene ID:
Human(79092) Summary: This gene encodes a caspase recruitment domain-containing protein that is a member of the membrane-associated guanylate kinase (MAGUK) family of proteins. Members of this protein family are scaffold proteins that are involved in a diverse array of cellular processes including cellular adhesion, signal transduction and cell polarity control. This protein has been shown to specifically interact with BCL10, a protein known to function as a positive regulator of cell apoptosis and NF-kappaB activation. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2012]
Mouse(170720) caspase recruitment domain family, member 14
Rat(688292) caspase recruitment domain family, member 14
sheep(101120931) caspase recruitment domain family, member 14
naked mole-rat(101720243) caspase recruitment domain family, member 14
domestic guinea pig(100733298) caspase recruitment domain family, member 14
Zebrafish(568689) caspase recruitment domain family, member 14
cow(523360) caspase recruitment domain family, member 14
Horse(100056542) caspase recruitment domain family, member 14
domestic cat(101086613) caspase recruitment domain family, member 14
dog(483353) caspase recruitment domain family, member 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024110 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024110 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024110 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_130886 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_130886 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_130886 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU083681 MISSION® esiRNA esiRNA targeting mouse Card14 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024110 Rosetta Predictions human pricing
NM_052819 Rosetta Predictions human pricing
XM_001081765 Rosetta Predictions rat pricing
NM_130886 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024110 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165288 predicted 1222
2 SASI_Hs01_00165289 predicted 1666
3 SASI_Hs01_00165290 predicted 1759
4 SASI_Hs02_00356602 predicted 1780
5 SASI_Hs01_00165293 predicted 1280
6 SASI_Hs01_00165294 predicted 1294
7 SASI_Hs01_00165295 predicted 1143
8 SASI_Hs01_00165296 predicted 1787
9 SASI_Hs01_00165297 predicted 1183
10 SASI_Hs02_00356603 predicted 1197
11 SASI_Hs01_00165291 predicted 1537
12 SASI_Hs01_00165292 predicted 1558
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052819 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028377 predicted 471
2 SASI_Hs01_00028378 predicted 921
3 SASI_Hs01_00028379 predicted 1007
4 SASI_Hs02_00361497 predicted 1040
5 SASI_Hs01_00028382 predicted 538
6 SASI_Hs01_00028383 predicted 545
7 SASI_Hs01_00028384 predicted 403
8 SASI_Hs01_00028385 predicted 1040
9 SASI_Hs01_00028386 predicted 435
10 SASI_Hs02_00361498 predicted 449
11 SASI_Hs01_00028380 predicted 791
12 SASI_Hs01_00028381 predicted 814
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081765 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00373362 predicted 2908
2 SASI_Rn02_00373363 predicted 1304
3 SASI_Rn02_00373364 predicted 2637
4 SASI_Rn02_00373365 predicted 2517
5 SASI_Rn02_00373366 predicted 2204
6 SASI_Rn02_00373367 predicted 628
7 SASI_Rn02_00373368 predicted 3283
8 SASI_Rn02_00373369 predicted 1366
9 SASI_Rn02_00373370 predicted 2606
10 SASI_Rn02_00373371 predicted 2248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130886 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057541 predicted 1135
2 SASI_Mm01_00057542 predicted 2359
3 SASI_Mm01_00057543 predicted 2263
4 SASI_Mm01_00057544 predicted 2615
5 SASI_Mm01_00057545 predicted 2608
6 SASI_Mm01_00057546 predicted 2397
7 SASI_Mm01_00057547 predicted 381
8 SASI_Mm01_00057548 predicted 640
9 SASI_Mm01_00057549 predicted 2315
10 SASI_Mm01_00057550 predicted 2152
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024110
CARD14 MISSION shRNA Bacterial Glycerol Stock
caspase recruitment domain family, member 14
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107195    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024110.2-3388s1c1
Sequence:CCGGGCCACTTGTAACTGCACACTTCTCGAGAAGTGTGCAGTTACAAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024110.2-2967s1c1
Sequence:CCGGCGTCTCTGTCAACGAGAAGATCTCGAGATCTTCTCGTTGACAGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024110.2-2355s1c1
Sequence:CCGGCGTGAACTCTTACACCATGAACTCGAGTTCATGGTGTAAGAGTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024110.2-2514s1c1
Sequence:CCGGCGTCAGTATGGACAAAGCCAACTCGAGTTGGCTTTGTCCATACTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024110.2-2034s1c1
Sequence:CCGGCCAGATTGTGATGGTTGATTACTCGAGTAATCAACCATCACAATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024110.2-2159s21c1
Sequence:CCGGAGGTCAACACGGACGGTTATACTCGAGTATAACCGTCCGTGTTGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024110.2-521s21c1
Sequence:CCGGATGTTGACTTCAGTAACTTTACTCGAGTAAAGTTACTGAAGTCAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359744    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024110.2-3554s21c1
Sequence:CCGGGTCTGCAGGCCCGATTCAAATCTCGAGATTTGAATCGGGCCTGCAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024110.2-2730s21c1
Sequence:CCGGGTGCCTCCTCCAAGGGTTTAACTCGAGTTAAACCCTTGGAGGAGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024110
CARD14 MISSION shRNA shRNA Plasmid DNA
caspase recruitment domain family, member 14
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107195    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024110.2-3388s1c1
Sequence:CCGGGCCACTTGTAACTGCACACTTCTCGAGAAGTGTGCAGTTACAAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024110.2-2967s1c1
Sequence:CCGGCGTCTCTGTCAACGAGAAGATCTCGAGATCTTCTCGTTGACAGAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024110.2-2355s1c1
Sequence:CCGGCGTGAACTCTTACACCATGAACTCGAGTTCATGGTGTAAGAGTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024110.2-2514s1c1
Sequence:CCGGCGTCAGTATGGACAAAGCCAACTCGAGTTGGCTTTGTCCATACTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024110.2-2034s1c1
Sequence:CCGGCCAGATTGTGATGGTTGATTACTCGAGTAATCAACCATCACAATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024110.2-2159s21c1
Sequence:CCGGAGGTCAACACGGACGGTTATACTCGAGTATAACCGTCCGTGTTGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024110.2-521s21c1
Sequence:CCGGATGTTGACTTCAGTAACTTTACTCGAGTAAAGTTACTGAAGTCAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359744    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024110.2-3554s21c1
Sequence:CCGGGTCTGCAGGCCCGATTCAAATCTCGAGATTTGAATCGGGCCTGCAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024110.2-2730s21c1
Sequence:CCGGGTGCCTCCTCCAAGGGTTTAACTCGAGTTAAACCCTTGGAGGAGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024110
CARD14 MISSION shRNA Lentiviral Transduction Particles
caspase recruitment domain family, member 14
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107195    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024110.2-3388s1c1
Sequence:CCGGGCCACTTGTAACTGCACACTTCTCGAGAAGTGTGCAGTTACAAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024110.2-2967s1c1
Sequence:CCGGCGTCTCTGTCAACGAGAAGATCTCGAGATCTTCTCGTTGACAGAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024110.2-2355s1c1
Sequence:CCGGCGTGAACTCTTACACCATGAACTCGAGTTCATGGTGTAAGAGTTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024110.2-2514s1c1
Sequence:CCGGCGTCAGTATGGACAAAGCCAACTCGAGTTGGCTTTGTCCATACTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024110.2-2034s1c1
Sequence:CCGGCCAGATTGTGATGGTTGATTACTCGAGTAATCAACCATCACAATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024110.2-2159s21c1
Sequence:CCGGAGGTCAACACGGACGGTTATACTCGAGTATAACCGTCCGTGTTGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024110.2-521s21c1
Sequence:CCGGATGTTGACTTCAGTAACTTTACTCGAGTAAAGTTACTGAAGTCAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359744    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024110.2-3554s21c1
Sequence:CCGGGTCTGCAGGCCCGATTCAAATCTCGAGATTTGAATCGGGCCTGCAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024110.2-2730s21c1
Sequence:CCGGGTGCCTCCTCCAAGGGTTTAACTCGAGTTAAACCCTTGGAGGAGGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130886
CARD14 MISSION shRNA Bacterial Glycerol Stock
caspase recruitment domain family, member 14
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176413    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_130886.2-3722s1c1
Sequence:CCGGCCACAGACATCTGCAAATGAACTCGAGTTCATTTGCAGATGTCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130886.2-2395s1c1
Sequence:CCGGGAACTGCAAACTCACTGCAATCTCGAGATTGCAGTGAGTTTGCAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130886.2-2052s1c1
Sequence:CCGGGCTGGAACAGATTGGTGTCATCTCGAGATGACACCAATCTGTTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130886.3-2982s21c1
Sequence:CCGGTGTGGAGTCCCTCATGAATATCTCGAGATATTCATGAGGGACTCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130886.3-2800s21c1
Sequence:CCGGGTGCTGTTTGTGCCTAGATTACTCGAGTAATCTAGGCACAAACAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130886.3-2280s21c1
Sequence:CCGGGATCAACACTGAAGGTTATAACTCGAGTTATAACCTTCAGTGTTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130886.3-2157s21c1
Sequence:CCGGGATCATGATGGTGGACTATAACTCGAGTTATAGTCCACCATCATGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130886.3-1107s21c1
Sequence:CCGGAGAAGAACTAAATCGGCTTAACTCGAGTTAAGCCGATTTAGTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130886.3-1333s21c1
Sequence:CCGGCAGGTGGACTGTGAACTATACCTCGAGGTATAGTTCACAGTCCACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130886.3-2195s21c1
Sequence:CCGGTAAGGGCCACTCTGGAGAATACTCGAGTATTCTCCAGAGTGGCCCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130886.3-2609s21c1
Sequence:CCGGCACAGAAGTTAGTACGAATTGCTCGAGCAATTCGTACTAACTTCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130886
CARD14 MISSION shRNA shRNA Plasmid DNA
caspase recruitment domain family, member 14
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176413    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_130886.2-3722s1c1
Sequence:CCGGCCACAGACATCTGCAAATGAACTCGAGTTCATTTGCAGATGTCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130886.2-2395s1c1
Sequence:CCGGGAACTGCAAACTCACTGCAATCTCGAGATTGCAGTGAGTTTGCAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130886.2-2052s1c1
Sequence:CCGGGCTGGAACAGATTGGTGTCATCTCGAGATGACACCAATCTGTTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130886.3-2982s21c1
Sequence:CCGGTGTGGAGTCCCTCATGAATATCTCGAGATATTCATGAGGGACTCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130886.3-2800s21c1
Sequence:CCGGGTGCTGTTTGTGCCTAGATTACTCGAGTAATCTAGGCACAAACAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130886.3-2280s21c1
Sequence:CCGGGATCAACACTGAAGGTTATAACTCGAGTTATAACCTTCAGTGTTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130886.3-2157s21c1
Sequence:CCGGGATCATGATGGTGGACTATAACTCGAGTTATAGTCCACCATCATGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130886.3-1107s21c1
Sequence:CCGGAGAAGAACTAAATCGGCTTAACTCGAGTTAAGCCGATTTAGTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130886.3-1333s21c1
Sequence:CCGGCAGGTGGACTGTGAACTATACCTCGAGGTATAGTTCACAGTCCACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130886.3-2195s21c1
Sequence:CCGGTAAGGGCCACTCTGGAGAATACTCGAGTATTCTCCAGAGTGGCCCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130886.3-2609s21c1
Sequence:CCGGCACAGAAGTTAGTACGAATTGCTCGAGCAATTCGTACTAACTTCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130886
CARD14 MISSION shRNA Lentiviral Transduction Particles
caspase recruitment domain family, member 14
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176413    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_130886.2-3722s1c1
Sequence:CCGGCCACAGACATCTGCAAATGAACTCGAGTTCATTTGCAGATGTCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130886.2-2395s1c1
Sequence:CCGGGAACTGCAAACTCACTGCAATCTCGAGATTGCAGTGAGTTTGCAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130886.2-2052s1c1
Sequence:CCGGGCTGGAACAGATTGGTGTCATCTCGAGATGACACCAATCTGTTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130886.3-2982s21c1
Sequence:CCGGTGTGGAGTCCCTCATGAATATCTCGAGATATTCATGAGGGACTCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130886.3-2800s21c1
Sequence:CCGGGTGCTGTTTGTGCCTAGATTACTCGAGTAATCTAGGCACAAACAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130886.3-2280s21c1
Sequence:CCGGGATCAACACTGAAGGTTATAACTCGAGTTATAACCTTCAGTGTTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130886.3-2157s21c1
Sequence:CCGGGATCATGATGGTGGACTATAACTCGAGTTATAGTCCACCATCATGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130886.3-1107s21c1
Sequence:CCGGAGAAGAACTAAATCGGCTTAACTCGAGTTAAGCCGATTTAGTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130886.3-1333s21c1
Sequence:CCGGCAGGTGGACTGTGAACTATACCTCGAGGTATAGTTCACAGTCCACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130886.3-2195s21c1
Sequence:CCGGTAAGGGCCACTCTGGAGAATACTCGAGTATTCTCCAGAGTGGCCCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130886.3-2609s21c1
Sequence:CCGGCACAGAAGTTAGTACGAATTGCTCGAGCAATTCGTACTAACTTCTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)