EMAIL THIS PAGE TO A FRIEND

CAV1

caveolin 1, caveolae protein, 22kDa

241 Gene Product Result for
Synonyms: BSCL3 CGL3 MSTP085 PPH3 VIP21
UniProtKB ID: Q03135, Q9UGP1, Q9UNG1, Q9UQH6
Gene ID:
Human(857) Summary: The scaffolding protein encoded by this gene is the main component of the caveolae plasma membranes found in most cell types. The protein links integrin subunits to the tyrosine kinase FYN, an initiating step in coupling integrins to the Ras-ERK pathway and promoting cell cycle progression. The gene is a tumor suppressor gene candidate and a negative regulator of the Ras-p42/44 mitogen-activated kinase cascade. Caveolin 1 and caveolin 2 are located next to each other on chromosome 7 and express colocalizing proteins that form a stable hetero-oligomeric complex. Mutations in this gene have been associated with Berardinelli-Seip congenital lipodystrophy. Alternatively spliced transcripts encode alpha and beta isoforms of caveolin 1.[provided by RefSeq, Mar 2010]
Mouse(12389) caveolin 1, caveolae protein
Rat(25404) caveolin 1, caveolae protein
Zebrafish(323695) caveolin 1
domestic cat(493668) caveolin 1, caveolae protein, 22kDa
Horse(100055975) caveolin 1, caveolae protein, 22kDa
cow(281040) caveolin 1, caveolae protein, 22kDa
dog(403980) caveolin 1, caveolae protein, 22kDa
chicken(373996) caveolin 1, caveolae protein, 22kDa
Goat(100860749) caveolin 1, caveolae protein, 22kDa
Domestic Rabbit(100008837) caveolin 1, caveolae protein, 22kDa
sheep(445468) caveolin 1, caveolae protein, 22kDa
naked mole-rat(101726366) caveolin 1, caveolae protein, 22kDa
domestic guinea pig(100135639) caveolin 1, caveolae protein
domestic guinea pig(100718512) caveolin 1, caveolae protein, 22kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300389 Anti-CAV1 (Ab-14) antibody produced in rabbit affinity isolated antibody human, mouse, rat
western blot pricing
SAB2900061 Anti-CAV1 (AB1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, dog, rat, monkey, sheep, human, bovine, pig, guinea pig, rabbit, horse
immunohistochemistry pricing
SAB2900062 Anti-CAV1 (AB2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry pricing
AV09019 Anti-CAV1 antibody produced in rabbit purified antibody, Protein A purified mouse, horse, pig, rat, human, canine, bovine, rabbit, sheep
immunohistochemistry, western blot pricing
SAB2900063 Anti-CAV1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry pricing
SAB2100344 Anti-CAV1 antibody produced in rabbit affinity isolated antibody mouse, horse, human, sheep, rat, rabbit
western blot pricing
HPA049326 Anti-CAV1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2500204 Anti-Caveolin 1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
C4490 Anti-Caveolin-1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human, rat
immunofluorescence, western blot pricing
C3237 Anti-Caveolin-1 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human, rat
immunofluorescence, microarray, western blot pricing
SAB5500033 Anti-Caveolin-1 antibody, Rabbit monoclonal clone SP43, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
immunohistochemistry pricing
SAB4503427 Anti-Caveolin-1, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, western blot pricing
SAB4503426 Anti-Caveolin-1, N-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4300071 Anti-phospho-CAV1 (pTyr14) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunofluorescence, western blot pricing
SAB4504357 Anti-phospho-Caveolin-1 (pTyr14) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB4200216 Monoclonal Anti-Caveolin-1 antibody produced in mouse clone CAV1, tissue culture supernatant human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001753 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001753 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001753 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007616 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007616 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007616 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001753 Rosetta Predictions human pricing
NM_031556 Rosetta Predictions rat pricing
NM_133651 Rosetta Predictions rat pricing
NM_007616 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001753 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199504 predicted 442
2 SASI_Hs02_00332472 predicted 436
3 SASI_Hs01_00199505 predicted 624
4 SASI_Hs02_00332473 predicted 887
5 SASI_Hs01_00199507 predicted 1073
6 SASI_Hs01_00199508 predicted 744
7 SASI_Hs02_00332474 predicted 780
8 SASI_Hs01_00199509 predicted 886
9 SASI_Hs01_00199511 predicted 881
10 SASI_Hs02_00332475 predicted 1097
11 SASI_Hs01_00199506 predicted 1083
12 SASI_Hs01_00199510 predicted 1090
13 SASI_Hs01_00199512 predicted 664
14 SASI_Hs01_00199513 predicted 659
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031556 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264757 predicted 1069
2 SASI_Rn02_00264758 predicted 800
3 SASI_Rn02_00264759 predicted 555
4 SASI_Rn02_00264760 predicted 968
5 SASI_Rn02_00264761 predicted 1054
6 SASI_Rn02_00264762 predicted 969
7 SASI_Rn02_00264763 predicted 420
8 SASI_Rn02_00264764 predicted 526
9 SASI_Rn02_00264765 predicted 478
10 SASI_Rn02_00264766 predicted 1065
11 SASI_Rn01_00109244 predicted 299
12 SASI_Rn01_00109245 predicted 243
13 SASI_Rn01_00109246 predicted 301
14 SASI_Rn01_00109247 predicted 229
15 SASI_Rn01_00109248 predicted 309
16 SASI_Rn01_00109249 predicted 213
17 SASI_Rn01_00109250 predicted 212
18 SASI_Rn01_00109251 predicted 242
19 SASI_Rn01_00109252 predicted 211
20 SASI_Rn01_00109253 predicted 311
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133651 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267855 predicted 1177
2 SASI_Rn02_00267856 predicted 902
3 SASI_Rn02_00267857 predicted 660
4 SASI_Rn02_00267858 predicted 1073
5 SASI_Rn02_00267859 predicted 1164
6 SASI_Rn02_00267860 predicted 1077
7 SASI_Rn01_00112737 predicted 532
8 SASI_Rn01_00112738 predicted 636
9 SASI_Rn01_00112740 predicted 592
10 SASI_Rn02_00267861 predicted 1170
11 SASI_Rn01_00112731 predicted 206
12 SASI_Rn01_00112732 predicted 202
13 SASI_Rn01_00112733 predicted 217
14 SASI_Rn01_00112734 predicted 224
15 SASI_Rn01_00112735 predicted 222
16 SASI_Rn01_00112736 predicted 400
17 SASI_Rn01_00112739 predicted 335
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007616 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141141 predicted 686
2 SASI_Mm01_00141142 predicted 552
3 SASI_Mm01_00141143 predicted 868
4 SASI_Mm01_00141144 predicted 767
5 SASI_Mm01_00141145 predicted 789
6 SASI_Mm01_00141146 predicted 596
7 SASI_Mm01_00141147 predicted 613
8 SASI_Mm02_00312070 predicted 697
9 SASI_Mm01_00141148 predicted 601
10 SASI_Mm01_00141149 predicted 741
11 SASI_Mm01_00141140 predicted 947
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001753
VALIDATED
CAV1 MISSION shRNA Bacterial Glycerol Stock
caveolin 1, caveolae protein, 22kDa
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001753.3-738s21c1
Sequence:GTACCGGACCGTCTGTGACCCACTCTTTCTCGAGAAAGAGTGGGTCACAGACGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001753.3-682s21c1
Sequence:GTACCGGAGAGCTTCCTGATTGAGATTCCTCGAGGAATCTCAATCAGGAAGCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001753.3-663s21c1
Sequence:GTACCGGGCAGTTGTACCATGCATTAAGCTCGAGCTTAATGCATGGTACAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001753.3-462s21c1
Sequence:CCGGGACGTGGTCAAGATTGACTTTCTCGAGAAAGTCAATCTTGACCACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001753.3-703s21c1
Sequence:CCGGAGTGCATCAGCCGTGTCTATTCTCGAGAATAGACACGGCTGATGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315311    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001753.3-2510s21c1
Sequence:CCGGGCTTTGTGATTCAATCTGTAACTCGAGTTACAGATTGAATCACAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001753.3-547s21c1
Sequence:CCGGCCACCTTCACTGTGACGAAATCTCGAGATTTCGTCACAGTGAAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001753.3-623s21c1
Sequence:GTACCGGGGGCATTTACTTCGCCATTCTCTCGAGAGAATGGCGAAGTAAATGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007999    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001753.3-2510s1c1
Sequence:CCGGGCTTTGTGATTCAATCTGTAACTCGAGTTACAGATTGAATCACAAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001753.3-462s1c1
Sequence:CCGGGACGTGGTCAAGATTGACTTTCTCGAGAAAGTCAATCTTGACCACGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001753.3-441s1c1
Sequence:CCGGGACCCTAAACACCTCAACGATCTCGAGATCGTTGAGGTGTTTAGGGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001753.3-547s1c1
Sequence:CCGGCCACCTTCACTGTGACGAAATCTCGAGATTTCGTCACAGTGAAGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_001753.3-747s1c1
Sequence:CCGGGACCCACTCTTTGAAGCTGTTCTCGAGAACAGCTTCAAAGAGTGGGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001753
VALIDATED
CAV1 MISSION shRNA shRNA Plasmid DNA
caveolin 1, caveolae protein, 22kDa
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001753.3-738s21c1
Sequence:GTACCGGACCGTCTGTGACCCACTCTTTCTCGAGAAAGAGTGGGTCACAGACGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001753.3-682s21c1
Sequence:GTACCGGAGAGCTTCCTGATTGAGATTCCTCGAGGAATCTCAATCAGGAAGCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001753.3-663s21c1
Sequence:GTACCGGGCAGTTGTACCATGCATTAAGCTCGAGCTTAATGCATGGTACAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001753.3-462s21c1
Sequence:CCGGGACGTGGTCAAGATTGACTTTCTCGAGAAAGTCAATCTTGACCACGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001753.3-703s21c1
Sequence:CCGGAGTGCATCAGCCGTGTCTATTCTCGAGAATAGACACGGCTGATGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315311    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001753.3-2510s21c1
Sequence:CCGGGCTTTGTGATTCAATCTGTAACTCGAGTTACAGATTGAATCACAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001753.3-547s21c1
Sequence:CCGGCCACCTTCACTGTGACGAAATCTCGAGATTTCGTCACAGTGAAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001753.3-623s21c1
Sequence:GTACCGGGGGCATTTACTTCGCCATTCTCTCGAGAGAATGGCGAAGTAAATGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007999    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001753.3-2510s1c1
Sequence:CCGGGCTTTGTGATTCAATCTGTAACTCGAGTTACAGATTGAATCACAAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001753.3-462s1c1
Sequence:CCGGGACGTGGTCAAGATTGACTTTCTCGAGAAAGTCAATCTTGACCACGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001753.3-441s1c1
Sequence:CCGGGACCCTAAACACCTCAACGATCTCGAGATCGTTGAGGTGTTTAGGGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001753.3-547s1c1
Sequence:CCGGCCACCTTCACTGTGACGAAATCTCGAGATTTCGTCACAGTGAAGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_001753.3-747s1c1
Sequence:CCGGGACCCACTCTTTGAAGCTGTTCTCGAGAACAGCTTCAAAGAGTGGGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001753
VALIDATED
CAV1 MISSION shRNA Lentiviral Transduction Particles
caveolin 1, caveolae protein, 22kDa
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001753.3-738s21c1
Sequence:GTACCGGACCGTCTGTGACCCACTCTTTCTCGAGAAAGAGTGGGTCACAGACGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001753.3-682s21c1
Sequence:GTACCGGAGAGCTTCCTGATTGAGATTCCTCGAGGAATCTCAATCAGGAAGCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001753.3-663s21c1
Sequence:GTACCGGGCAGTTGTACCATGCATTAAGCTCGAGCTTAATGCATGGTACAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001753.3-462s21c1
Sequence:CCGGGACGTGGTCAAGATTGACTTTCTCGAGAAAGTCAATCTTGACCACGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001753.3-703s21c1
Sequence:CCGGAGTGCATCAGCCGTGTCTATTCTCGAGAATAGACACGGCTGATGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315311    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001753.3-2510s21c1
Sequence:CCGGGCTTTGTGATTCAATCTGTAACTCGAGTTACAGATTGAATCACAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001753.3-547s21c1
Sequence:CCGGCCACCTTCACTGTGACGAAATCTCGAGATTTCGTCACAGTGAAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001753.3-623s21c1
Sequence:GTACCGGGGGCATTTACTTCGCCATTCTCTCGAGAGAATGGCGAAGTAAATGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007999    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001753.3-2510s1c1
Sequence:CCGGGCTTTGTGATTCAATCTGTAACTCGAGTTACAGATTGAATCACAAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001753.3-462s1c1
Sequence:CCGGGACGTGGTCAAGATTGACTTTCTCGAGAAAGTCAATCTTGACCACGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001753.3-441s1c1
Sequence:CCGGGACCCTAAACACCTCAACGATCTCGAGATCGTTGAGGTGTTTAGGGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001753.3-547s1c1
Sequence:CCGGCCACCTTCACTGTGACGAAATCTCGAGATTTCGTCACAGTGAAGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_001753.3-747s1c1
Sequence:CCGGGACCCACTCTTTGAAGCTGTTCTCGAGAACAGCTTCAAAGAGTGGGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007616
VALIDATED
CAV1 MISSION shRNA Bacterial Glycerol Stock
caveolin 1, caveolae protein, 22kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000335748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007616.3-560s21c1
Sequence:CCGGTGAAGCTATTGGCAAGATATTCTCGAGAATATCTTGCCAATAGCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007616.3-263s21c1
Sequence:CCGGCGACGTGGTCAAGATTGACTTCTCGAGAAGTCAATCTTGACCACGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007616.3-380s21c1
Sequence:CCGGCCGCTTGTTGTCTACGATCTTCTCGAGAAGATCGTAGACAACAAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007616.3-487s21c1
Sequence:CCGGGCTTCCTGATTGAGATTCAGTCTCGAGACTGAATCTCAATCAGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007616.2-560s1c1
Sequence:CCGGTGAAGCTATTGGCAAGATATTCTCGAGAATATCTTGCCAATAGCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007616.2-263s1c1
Sequence:CCGGCGACGTGGTCAAGATTGACTTCTCGAGAAGTCAATCTTGACCACGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007616.2-487s1c1
Sequence:CCGGGCTTCCTGATTGAGATTCAGTCTCGAGACTGAATCTCAATCAGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112660    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007616.2-1078s1c1
Sequence:CCGGCCAGTTAGATTTAGGGATTTACTCGAGTAAATCCCTAAATCTAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007616.2-380s1c1
Sequence:CCGGCCGCTTGTTGTCTACGATCTTCTCGAGAAGATCGTAGACAACAAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007616
VALIDATED
CAV1 MISSION shRNA shRNA Plasmid DNA
caveolin 1, caveolae protein, 22kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000335748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007616.3-560s21c1
Sequence:CCGGTGAAGCTATTGGCAAGATATTCTCGAGAATATCTTGCCAATAGCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007616.3-263s21c1
Sequence:CCGGCGACGTGGTCAAGATTGACTTCTCGAGAAGTCAATCTTGACCACGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007616.3-380s21c1
Sequence:CCGGCCGCTTGTTGTCTACGATCTTCTCGAGAAGATCGTAGACAACAAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007616.3-487s21c1
Sequence:CCGGGCTTCCTGATTGAGATTCAGTCTCGAGACTGAATCTCAATCAGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007616.2-560s1c1
Sequence:CCGGTGAAGCTATTGGCAAGATATTCTCGAGAATATCTTGCCAATAGCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007616.2-263s1c1
Sequence:CCGGCGACGTGGTCAAGATTGACTTCTCGAGAAGTCAATCTTGACCACGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007616.2-487s1c1
Sequence:CCGGGCTTCCTGATTGAGATTCAGTCTCGAGACTGAATCTCAATCAGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112660    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007616.2-1078s1c1
Sequence:CCGGCCAGTTAGATTTAGGGATTTACTCGAGTAAATCCCTAAATCTAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007616.2-380s1c1
Sequence:CCGGCCGCTTGTTGTCTACGATCTTCTCGAGAAGATCGTAGACAACAAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007616
VALIDATED
CAV1 MISSION shRNA Lentiviral Transduction Particles
caveolin 1, caveolae protein, 22kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000335748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007616.3-560s21c1
Sequence:CCGGTGAAGCTATTGGCAAGATATTCTCGAGAATATCTTGCCAATAGCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007616.3-263s21c1
Sequence:CCGGCGACGTGGTCAAGATTGACTTCTCGAGAAGTCAATCTTGACCACGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007616.3-380s21c1
Sequence:CCGGCCGCTTGTTGTCTACGATCTTCTCGAGAAGATCGTAGACAACAAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007616.3-487s21c1
Sequence:CCGGGCTTCCTGATTGAGATTCAGTCTCGAGACTGAATCTCAATCAGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007616.2-560s1c1
Sequence:CCGGTGAAGCTATTGGCAAGATATTCTCGAGAATATCTTGCCAATAGCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007616.2-263s1c1
Sequence:CCGGCGACGTGGTCAAGATTGACTTCTCGAGAAGTCAATCTTGACCACGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007616.2-487s1c1
Sequence:CCGGGCTTCCTGATTGAGATTCAGTCTCGAGACTGAATCTCAATCAGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112660    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007616.2-1078s1c1
Sequence:CCGGCCAGTTAGATTTAGGGATTTACTCGAGTAAATCCCTAAATCTAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007616.2-380s1c1
Sequence:CCGGCCGCTTGTTGTCTACGATCTTCTCGAGAAGATCGTAGACAACAAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)