EMAIL THIS PAGE TO A FRIEND

CBS

cystathionine-beta-synthase

65 Gene Product Result for
Synonyms: HIP4
UniProtKB ID: P35520, B2R993, D3DSK4, Q99425, Q9BWC5
Gene ID:
Human(875) Summary: The protein encoded by this gene acts as a homotetramer to catalyze the conversion of homocysteine to cystathionine, the first step in the transsulfuration pathway. The encoded protein is allosterically activated by adenosyl-methionine and uses pyridoxal phosphate as a cofactor. Defects in this gene can cause cystathionine beta-synthase deficiency (CBSD), which can lead to homocystinuria. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2010]
Mouse(12411) cystathionine beta-synthase
Rat(24250) cystathionine beta synthase
naked mole-rat(101703797) cystathionine-beta-synthase
domestic guinea pig(100734876) cystathionine-beta-synthase
sheep(101106301) cystathionine-beta-synthase
Domestic Rabbit(100008766) cystathionine-beta-synthase
fruit fly(5657009) Calcium-binding protein in Shaker
cow(514525) cystathionine-beta-synthase
domestic cat(101093038) cystathionine-beta-synthase
dog(611071) cystathionine-beta-synthase
fruit fly(36492) centrosomin's beautiful sister
chicken(418545) cystathionine-beta-synthase
fruit fly(33081) Cystathionine beta-synthase
Gene Class: Dehydratase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178224 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178224 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178224 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000071 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000071 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000071 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000071 Rosetta Predictions human pricing
NM_012522 Rosetta Predictions rat pricing
NM_144855 Rosetta Predictions mouse pricing
NM_178224 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000071 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214623 predicted 1785
2 SASI_Hs01_00214624 predicted 1167
3 SASI_Hs01_00214625 predicted 449
4 SASI_Hs01_00214626 predicted 540
5 SASI_Hs01_00214627 predicted 661
6 SASI_Hs01_00214629 predicted 1874
7 SASI_Hs02_00301801 predicted 1620
8 SASI_Hs01_00214630 predicted 1605
9 SASI_Hs01_00214631 predicted 1897
10 SASI_Hs02_00301802 predicted 685
11 SASI_Hs01_00214628 predicted 499
12 SASI_Hs01_00214632 predicted 1318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012522 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112250 predicted 639
2 SASI_Rn01_00112251 predicted 1269
3 SASI_Rn01_00112252 predicted 1028
4 SASI_Rn01_00112253 predicted 1281
5 SASI_Rn01_00112255 predicted 940
6 SASI_Rn01_00112254 predicted 1736
7 SASI_Rn01_00112256 predicted 778
8 SASI_Rn01_00112257 predicted 624
9 SASI_Rn01_00112258 predicted 1090
10 SASI_Rn01_00112259 predicted 426
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144855 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192072 predicted 801
2 SASI_Mm01_00192073 predicted 364
3 SASI_Mm01_00192074 predicted 1067
4 SASI_Mm01_00192075 predicted 816
5 SASI_Mm01_00192076 predicted 912
6 SASI_Mm01_00192077 predicted 1069
7 SASI_Mm02_00340275 predicted 574
8 SASI_Mm01_00192078 predicted 818
9 SASI_Mm01_00192079 predicted 802
10 SASI_Mm01_00192080 predicted 456
11 SASI_Mm01_00192081 predicted 550
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178224 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075593 predicted 786
2 SASI_Mm01_00075594 predicted 351
3 SASI_Mm01_00075595 predicted 1065
4 SASI_Mm01_00075596 predicted 807
5 SASI_Mm01_00075597 predicted 899
6 SASI_Mm01_00075598 predicted 1061
7 SASI_Mm02_00348627 predicted 570
8 SASI_Mm01_00075599 predicted 810
9 SASI_Mm01_00075600 predicted 791
10 SASI_Mm01_00075602 predicted 445
11 SASI_Mm01_00075601 predicted 1664
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178224
CBS MISSION shRNA Bacterial Glycerol Stock
cystathionine-beta-synthase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178224.1-1943s1c1
Sequence:CCGGGCTACCTAAATGAATCCTCTACTCGAGTAGAGGATTCATTTAGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178224.1-428s1c1
Sequence:CCGGCCCTATGGTCAGAATCAACAACTCGAGTTGTTGATTCTGACCATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178224.1-586s1c1
Sequence:CCGGACACTATCATTGAGCCAACTTCTCGAGAAGTTGGCTCAATGATAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178224.1-1587s1c1
Sequence:CCGGCCATCAGACGAAGTCTGCAAACTCGAGTTTGCAGACTTCGTCTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178224.2-646s21c1
Sequence:CCGGTGAAGGGCTATCGCTGCATTACTCGAGTAATGCAGCGATAGCCCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178224.2-948s21c1
Sequence:CCGGATCACAGGGATCGCCAGAAAGCTCGAGCTTTCTGGCGATCCCTGTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178224.2-897s21c1
Sequence:CCGGTGTGACGGGAAGCTGGATATGCTCGAGCATATCCAGCTTCCCGTCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178224.2-1698s21c1
Sequence:CCGGGTCCACGAGCAGATCCAATACCTCGAGGTATTGGATCTGCTCGTGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178224
CBS MISSION shRNA shRNA Plasmid DNA
cystathionine-beta-synthase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178224.1-1943s1c1
Sequence:CCGGGCTACCTAAATGAATCCTCTACTCGAGTAGAGGATTCATTTAGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178224.1-428s1c1
Sequence:CCGGCCCTATGGTCAGAATCAACAACTCGAGTTGTTGATTCTGACCATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178224.1-586s1c1
Sequence:CCGGACACTATCATTGAGCCAACTTCTCGAGAAGTTGGCTCAATGATAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178224.1-1587s1c1
Sequence:CCGGCCATCAGACGAAGTCTGCAAACTCGAGTTTGCAGACTTCGTCTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178224.2-646s21c1
Sequence:CCGGTGAAGGGCTATCGCTGCATTACTCGAGTAATGCAGCGATAGCCCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178224.2-948s21c1
Sequence:CCGGATCACAGGGATCGCCAGAAAGCTCGAGCTTTCTGGCGATCCCTGTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178224.2-897s21c1
Sequence:CCGGTGTGACGGGAAGCTGGATATGCTCGAGCATATCCAGCTTCCCGTCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178224.2-1698s21c1
Sequence:CCGGGTCCACGAGCAGATCCAATACCTCGAGGTATTGGATCTGCTCGTGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178224
CBS MISSION shRNA Lentiviral Transduction Particles
cystathionine-beta-synthase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178224.1-1943s1c1
Sequence:CCGGGCTACCTAAATGAATCCTCTACTCGAGTAGAGGATTCATTTAGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178224.1-428s1c1
Sequence:CCGGCCCTATGGTCAGAATCAACAACTCGAGTTGTTGATTCTGACCATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178224.1-586s1c1
Sequence:CCGGACACTATCATTGAGCCAACTTCTCGAGAAGTTGGCTCAATGATAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178224.1-1587s1c1
Sequence:CCGGCCATCAGACGAAGTCTGCAAACTCGAGTTTGCAGACTTCGTCTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178224.2-646s21c1
Sequence:CCGGTGAAGGGCTATCGCTGCATTACTCGAGTAATGCAGCGATAGCCCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178224.2-948s21c1
Sequence:CCGGATCACAGGGATCGCCAGAAAGCTCGAGCTTTCTGGCGATCCCTGTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178224.2-897s21c1
Sequence:CCGGTGTGACGGGAAGCTGGATATGCTCGAGCATATCCAGCTTCCCGTCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178224.2-1698s21c1
Sequence:CCGGGTCCACGAGCAGATCCAATACCTCGAGGTATTGGATCTGCTCGTGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000071
VALIDATED
CBS MISSION shRNA Bacterial Glycerol Stock
cystathionine-beta-synthase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000071.1-409s1c1
Sequence:CCGGCTTGCCAGATATTCTGAAGAACTCGAGTTCTTCAGAATATCTGGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000071.1-1315s1c1
Sequence:CCGGGCGGAACTACATGACCAAGTTCTCGAGAACTTGGTCATGTAGTTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000071.1-1604s1c1
Sequence:CCGGCCGTCAGACCAAGTTGGCAAACTCGAGTTTGCCAACTTGGTCTGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000071.1-600s1c1
Sequence:CCGGACACGATTATCGAGCCGACATCTCGAGATGTCGGCTCGATAATCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000071.2-1668s21c1
Sequence:CCGGCCGTCAGACCAAGTTGGCAAACTCGAGTTTGCCAACTTGGTCTGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000071.2-664s21c1
Sequence:CCGGACACGATTATCGAGCCGACATCTCGAGATGTCGGCTCGATAATCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000071.2-1379s21c1
Sequence:CCGGGCGGAACTACATGACCAAGTTCTCGAGAACTTGGTCATGTAGTTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000071.2-473s21c1
Sequence:CCGGCTTGCCAGATATTCTGAAGAACTCGAGTTCTTCAGAATATCTGGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308284    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000071.2-2194s21c1
Sequence:CCGGGACTGCGCAGAGTGGATTAAACTCGAGTTTAATCCACTCTGCGCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000071
VALIDATED
CBS MISSION shRNA shRNA Plasmid DNA
cystathionine-beta-synthase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000071.1-409s1c1
Sequence:CCGGCTTGCCAGATATTCTGAAGAACTCGAGTTCTTCAGAATATCTGGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000071.1-1315s1c1
Sequence:CCGGGCGGAACTACATGACCAAGTTCTCGAGAACTTGGTCATGTAGTTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000071.1-1604s1c1
Sequence:CCGGCCGTCAGACCAAGTTGGCAAACTCGAGTTTGCCAACTTGGTCTGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000071.1-600s1c1
Sequence:CCGGACACGATTATCGAGCCGACATCTCGAGATGTCGGCTCGATAATCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000071.2-1668s21c1
Sequence:CCGGCCGTCAGACCAAGTTGGCAAACTCGAGTTTGCCAACTTGGTCTGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000071.2-664s21c1
Sequence:CCGGACACGATTATCGAGCCGACATCTCGAGATGTCGGCTCGATAATCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000071.2-1379s21c1
Sequence:CCGGGCGGAACTACATGACCAAGTTCTCGAGAACTTGGTCATGTAGTTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000071.2-473s21c1
Sequence:CCGGCTTGCCAGATATTCTGAAGAACTCGAGTTCTTCAGAATATCTGGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308284    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000071.2-2194s21c1
Sequence:CCGGGACTGCGCAGAGTGGATTAAACTCGAGTTTAATCCACTCTGCGCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000071
VALIDATED
CBS MISSION shRNA Lentiviral Transduction Particles
cystathionine-beta-synthase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000071.1-409s1c1
Sequence:CCGGCTTGCCAGATATTCTGAAGAACTCGAGTTCTTCAGAATATCTGGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000071.1-1315s1c1
Sequence:CCGGGCGGAACTACATGACCAAGTTCTCGAGAACTTGGTCATGTAGTTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000071.1-1604s1c1
Sequence:CCGGCCGTCAGACCAAGTTGGCAAACTCGAGTTTGCCAACTTGGTCTGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000071.1-600s1c1
Sequence:CCGGACACGATTATCGAGCCGACATCTCGAGATGTCGGCTCGATAATCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000071.2-1668s21c1
Sequence:CCGGCCGTCAGACCAAGTTGGCAAACTCGAGTTTGCCAACTTGGTCTGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000071.2-664s21c1
Sequence:CCGGACACGATTATCGAGCCGACATCTCGAGATGTCGGCTCGATAATCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000071.2-1379s21c1
Sequence:CCGGGCGGAACTACATGACCAAGTTCTCGAGAACTTGGTCATGTAGTTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000071.2-473s21c1
Sequence:CCGGCTTGCCAGATATTCTGAAGAACTCGAGTTCTTCAGAATATCTGGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308284    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000071.2-2194s21c1
Sequence:CCGGGACTGCGCAGAGTGGATTAAACTCGAGTTTAATCCACTCTGCGCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)