EMAIL THIS PAGE TO A FRIEND

CBWD2

COBW domain containing 2

21 Gene Product Result for
UniProtKB ID: Q8IUF1, Q0VAN3
Gene ID:
naked mole-rat(101699041) COBW domain containing 2
domestic guinea pig(100727870) COBW domain containing 2
sheep(101108887) COBW domain containing 2
cow(100300568) COBW domain containing 5
domestic cat(101080413) COBW domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2702394 Anti-CBWD2 antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172003 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_172003 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_172003 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU147501 MISSION® esiRNA esiRNA human CBWD2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_172003 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172003 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088079 predicted 986
2 SASI_Hs01_00088081 predicted 982
3 SASI_Hs01_00088083 predicted 994
4 SASI_Hs02_00367765 predicted 920
5 SASI_Hs02_00367766 predicted 977
6 SASI_Hs02_00367767 predicted 996
7 SASI_Hs02_00367768 predicted 997
8 SASI_Hs02_00367769 predicted 921
9 SASI_Hs02_00367770 predicted 916
10 SASI_Hs01_00088084 predicted 919
11 SASI_Hs01_00088078 predicted 213
12 SASI_Hs01_00088080 predicted 297
13 SASI_Hs01_00088082 predicted 227
14 SASI_Hs01_00088085 predicted 225
15 SASI_Hs01_00088086 predicted 226
16 SASI_Hs01_00088087 predicted 315
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172003
VALIDATED
CBWD2 MISSION shRNA Bacterial Glycerol Stock
COBW domain containing 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_172003.2-1186s1c1
Sequence:CCGGGCTACTGTGACAGAAACAGAACTCGAGTTCTGTTTCTGTCACAGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_172003.2-713s1c1
Sequence:CCGGGAGCGACAATTAGATCCATAACTCGAGTTATGGATCTAATTGTCGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_172003.2-349s1c1
Sequence:CCGGCTCTATGAAGAGTGGCTGGAACTCGAGTTCCAGCCACTCTTCATAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_172003.2-182s1c1
Sequence:CCGGCCAAGATCCCAGTCACAATTACTCGAGTAATTGTGACTGGGATCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_172003.2-865s1c1
Sequence:CCGGCCTCACCTTGATCAGAGTATTCTCGAGAATACTCTGATCAAGGTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172003.3-1692s21c1
Sequence:CCGGAGCTGATTGCAGAGATATAATCTCGAGATTATATCTCTGCAATCAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172003.3-1249s21c1
Sequence:CCGGGGTCCTCCTTGGCAGAAATTTCTCGAGAAATTTCTGCCAAGGAGGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172003.3-1657s21c1
Sequence:CCGGCAACTTTCAACATTGTCATTTCTCGAGAAATGACAATGTTGAAAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172003.3-345s21c1
Sequence:CCGGCAACACTTCTGAACTATATTTCTCGAGAAATATAGTTCAGAAGTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172003.3-767s21c1
Sequence:CCGGGCAGATGCCATTCTCATTAATCTCGAGATTAATGAGAATGGCATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172003
VALIDATED
CBWD2 MISSION shRNA shRNA Plasmid DNA
COBW domain containing 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_172003.2-1186s1c1
Sequence:CCGGGCTACTGTGACAGAAACAGAACTCGAGTTCTGTTTCTGTCACAGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_172003.2-713s1c1
Sequence:CCGGGAGCGACAATTAGATCCATAACTCGAGTTATGGATCTAATTGTCGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_172003.2-349s1c1
Sequence:CCGGCTCTATGAAGAGTGGCTGGAACTCGAGTTCCAGCCACTCTTCATAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_172003.2-182s1c1
Sequence:CCGGCCAAGATCCCAGTCACAATTACTCGAGTAATTGTGACTGGGATCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_172003.2-865s1c1
Sequence:CCGGCCTCACCTTGATCAGAGTATTCTCGAGAATACTCTGATCAAGGTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172003.3-1692s21c1
Sequence:CCGGAGCTGATTGCAGAGATATAATCTCGAGATTATATCTCTGCAATCAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172003.3-1249s21c1
Sequence:CCGGGGTCCTCCTTGGCAGAAATTTCTCGAGAAATTTCTGCCAAGGAGGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172003.3-1657s21c1
Sequence:CCGGCAACTTTCAACATTGTCATTTCTCGAGAAATGACAATGTTGAAAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172003.3-345s21c1
Sequence:CCGGCAACACTTCTGAACTATATTTCTCGAGAAATATAGTTCAGAAGTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172003.3-767s21c1
Sequence:CCGGGCAGATGCCATTCTCATTAATCTCGAGATTAATGAGAATGGCATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172003
VALIDATED
CBWD2 MISSION shRNA Lentiviral Transduction Particles
COBW domain containing 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_172003.2-1186s1c1
Sequence:CCGGGCTACTGTGACAGAAACAGAACTCGAGTTCTGTTTCTGTCACAGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_172003.2-713s1c1
Sequence:CCGGGAGCGACAATTAGATCCATAACTCGAGTTATGGATCTAATTGTCGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_172003.2-349s1c1
Sequence:CCGGCTCTATGAAGAGTGGCTGGAACTCGAGTTCCAGCCACTCTTCATAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_172003.2-182s1c1
Sequence:CCGGCCAAGATCCCAGTCACAATTACTCGAGTAATTGTGACTGGGATCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_172003.2-865s1c1
Sequence:CCGGCCTCACCTTGATCAGAGTATTCTCGAGAATACTCTGATCAAGGTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172003.3-1692s21c1
Sequence:CCGGAGCTGATTGCAGAGATATAATCTCGAGATTATATCTCTGCAATCAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172003.3-1249s21c1
Sequence:CCGGGGTCCTCCTTGGCAGAAATTTCTCGAGAAATTTCTGCCAAGGAGGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172003.3-1657s21c1
Sequence:CCGGCAACTTTCAACATTGTCATTTCTCGAGAAATGACAATGTTGAAAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172003.3-345s21c1
Sequence:CCGGCAACACTTCTGAACTATATTTCTCGAGAAATATAGTTCAGAAGTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172003.3-767s21c1
Sequence:CCGGGCAGATGCCATTCTCATTAATCTCGAGATTAATGAGAATGGCATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)