EMAIL THIS PAGE TO A FRIEND

CBWD5

COBW domain containing 5

163 Gene Product Result for
Synonyms: DC36
Species: Human CBWD5(220869)
UniProtKB ID: Q5RIA9, Q8N7U8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001024916 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001024916 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001024916 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024916 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024916 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120587 predicted 494
2 SASI_Hs01_00120584 predicted 267
3 SASI_Hs02_00307257 predicted 212
4 SASI_Hs01_00120589 predicted 438
5 SASI_Hs01_00120585 predicted 886
6 SASI_Hs01_00120590 predicted 440
7 SASI_Hs02_00307258 predicted 223
8 SASI_Hs02_00307259 predicted 911
9 SASI_Hs02_00307260 predicted 760
10 SASI_Hs02_00307261 predicted 928
11 SASI_Hs01_00120582 predicted 599
12 SASI_Hs01_00120583 predicted 755
13 SASI_Hs01_00120586 predicted 325
14 SASI_Hs01_00120588 predicted 758
15 SASI_Hs01_00120591 predicted 384
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024916
CBWD5 MISSION shRNA Bacterial Glycerol Stock
COBW domain containing 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024916.2-1381s21c1
Sequence:CCGGGAAATTGGCTTTGGAGTTTACCTCGAGGTAAACTCCAAAGCCAATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024916.2-1030s21c1
Sequence:CCGGGGTCCTCATTGGCAGAAATTTCTCGAGAAATTTCTGCCAATGAGGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024916.2-882s21c1
Sequence:CCGGATCACTGCATGGAGGTCATAACTCGAGTTATGACCTCCATGCAGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024916.2-707s21c1
Sequence:CCGGGAAACACAAAGATCAAGTTTGCTCGAGCAAACTTGATCTTTGTGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024916.2-667s21c1
Sequence:CCGGTGAAGCTACTAGATCCATAAACTCGAGTTTATGGATCTAGTAGCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024916
CBWD5 MISSION shRNA shRNA Plasmid DNA
COBW domain containing 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024916.2-1381s21c1
Sequence:CCGGGAAATTGGCTTTGGAGTTTACCTCGAGGTAAACTCCAAAGCCAATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024916.2-1030s21c1
Sequence:CCGGGGTCCTCATTGGCAGAAATTTCTCGAGAAATTTCTGCCAATGAGGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024916.2-882s21c1
Sequence:CCGGATCACTGCATGGAGGTCATAACTCGAGTTATGACCTCCATGCAGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024916.2-707s21c1
Sequence:CCGGGAAACACAAAGATCAAGTTTGCTCGAGCAAACTTGATCTTTGTGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024916.2-667s21c1
Sequence:CCGGTGAAGCTACTAGATCCATAAACTCGAGTTTATGGATCTAGTAGCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024916
CBWD5 MISSION shRNA Lentiviral Transduction Particles
COBW domain containing 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024916.2-1381s21c1
Sequence:CCGGGAAATTGGCTTTGGAGTTTACCTCGAGGTAAACTCCAAAGCCAATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024916.2-1030s21c1
Sequence:CCGGGGTCCTCATTGGCAGAAATTTCTCGAGAAATTTCTGCCAATGAGGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024916.2-882s21c1
Sequence:CCGGATCACTGCATGGAGGTCATAACTCGAGTTATGACCTCCATGCAGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024916.2-707s21c1
Sequence:CCGGGAAACACAAAGATCAAGTTTGCTCGAGCAAACTTGATCTTTGTGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024916.2-667s21c1
Sequence:CCGGTGAAGCTACTAGATCCATAAACTCGAGTTTATGGATCTAGTAGCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)