EMAIL THIS PAGE TO A FRIEND

CCAR1

cell division cycle and apoptosis regulator 1

101 Gene Product Result for
Synonyms: RP11-437A18.1
Gene ID:
Mouse(67500) cell division cycle and apoptosis regulator 1
Rat(361849) cell division cycle and apoptosis regulator 1
Zebrafish(337744) cell division cycle and apoptosis regulator 1
cow(767587) cell division cycle and apoptosis regulator 1
Horse(100063156) cell division cycle and apoptosis regulator 1
domestic cat(101091814) cell division cycle and apoptosis regulator 1
dog(479230) cell division cycle and apoptosis regulator 1
chicken(423692) cell division cycle and apoptosis regulator 1
naked mole-rat(101703576) cell division cycle and apoptosis regulator 1
domestic guinea pig(100719892) cell division cycle and apoptosis regulator 1
sheep(101106390) cell division cycle and apoptosis regulator 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018237 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018237 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018237 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026201 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026201 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026201 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018237 Rosetta Predictions human pricing
NM_001108535 Rosetta Predictions rat pricing
NM_026201 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018237 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115830 predicted 491
2 SASI_Hs01_00115831 predicted 3459
3 SASI_Hs02_00351576 predicted 1411
4 SASI_Hs01_00115832 predicted 3547
5 SASI_Hs01_00115833 predicted 1550
6 SASI_Hs01_00115835 predicted 1840
7 SASI_Hs01_00115836 predicted 3147
8 SASI_Hs01_00115837 predicted 3212
9 SASI_Hs02_00351577 predicted 3043
10 SASI_Hs02_00351578 predicted 1721
11 SASI_Hs01_00115829 predicted 1383
12 SASI_Hs01_00115834 predicted 3469
13 SASI_Hs01_00115838 predicted 2983
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108535 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239599 predicted 1320
2 SASI_Rn02_00239600 predicted 587
3 SASI_Rn02_00239601 predicted 1055
4 SASI_Rn02_00239602 predicted 3725
5 SASI_Rn02_00239603 predicted 3644
6 SASI_Rn02_00239604 predicted 410
7 SASI_Rn02_00239605 predicted 2210
8 SASI_Rn02_00239606 predicted 1312
9 SASI_Rn02_00239607 predicted 3204
10 SASI_Rn02_00239608 predicted 3086
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026201 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045214 predicted 1230
2 SASI_Mm01_00045215 predicted 1438
3 SASI_Mm02_00329868 predicted 3555
4 SASI_Mm01_00045216 predicted 1645
5 SASI_Mm01_00045217 predicted 712
6 SASI_Mm01_00045218 predicted 1403
7 SASI_Mm01_00045220 predicted 2934
8 SASI_Mm02_00329869 predicted 3613
9 SASI_Mm01_00045221 predicted 1217
10 SASI_Mm01_00045222 predicted 617
11 SASI_Mm01_00045219 predicted 2062
12 SASI_Mm01_00045223 predicted 3427
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018237
VALIDATED
CCAR1 MISSION shRNA Bacterial Glycerol Stock
cell division cycle and apoptosis regulator 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018237.1-351s1c1
Sequence:CCGGGCTGCATTACAACAGCAATATCTCGAGATATTGCTGTTGTAATGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018237.1-3104s1c1
Sequence:CCGGGCAGGAAGATATGCTAGGAAACTCGAGTTTCCTAGCATATCTTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018237.1-234s1c1
Sequence:CCGGCCTACCATTTATACACAGCAACTCGAGTTGCTGTGTATAAATGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018237.1-879s1c1
Sequence:CCGGGCAGCTTCTATTACACCACTACTCGAGTAGTGGTGTAATAGAAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018237.1-1480s1c1
Sequence:CCGGGCCCTAGTATGGAAGATTTATCTCGAGATAAATCTTCCATACTAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018237.2-224s21c1
Sequence:CCGGTGGAGCATCTCCTACCATTTACTCGAGTAAATGGTAGGAGATGCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018237.2-1433s21c1
Sequence:CCGGACCAGATGCTGACCACTTATACTCGAGTATAAGTGGTCAGCATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018237.2-677s21c1
Sequence:CCGGATTGGTTGAAGCTACTTATAACTCGAGTTATAAGTAGCTTCAACCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018237.2-907s21c1
Sequence:CCGGCTCAACCACAGCCCTTATTACCTCGAGGTAATAAGGGCTGTGGTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018237.2-2202s21c1
Sequence:CCGGAGGAAATCTGAAGACGATAAACTCGAGTTTATCGTCTTCAGATTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018237.2-2264s21c1
Sequence:CCGGGCGTCGAGAAAGAAGATATATCTCGAGATATATCTTCTTTCTCGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018237.2-1675s21c1
Sequence:CCGGTGTTGATTAAGACTGCTATTCCTCGAGGAATAGCAGTCTTAATCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018237
VALIDATED
CCAR1 MISSION shRNA shRNA Plasmid DNA
cell division cycle and apoptosis regulator 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018237.1-351s1c1
Sequence:CCGGGCTGCATTACAACAGCAATATCTCGAGATATTGCTGTTGTAATGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018237.1-3104s1c1
Sequence:CCGGGCAGGAAGATATGCTAGGAAACTCGAGTTTCCTAGCATATCTTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018237.1-234s1c1
Sequence:CCGGCCTACCATTTATACACAGCAACTCGAGTTGCTGTGTATAAATGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018237.1-879s1c1
Sequence:CCGGGCAGCTTCTATTACACCACTACTCGAGTAGTGGTGTAATAGAAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018237.1-1480s1c1
Sequence:CCGGGCCCTAGTATGGAAGATTTATCTCGAGATAAATCTTCCATACTAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018237.2-224s21c1
Sequence:CCGGTGGAGCATCTCCTACCATTTACTCGAGTAAATGGTAGGAGATGCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018237.2-1433s21c1
Sequence:CCGGACCAGATGCTGACCACTTATACTCGAGTATAAGTGGTCAGCATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018237.2-677s21c1
Sequence:CCGGATTGGTTGAAGCTACTTATAACTCGAGTTATAAGTAGCTTCAACCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018237.2-907s21c1
Sequence:CCGGCTCAACCACAGCCCTTATTACCTCGAGGTAATAAGGGCTGTGGTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018237.2-2202s21c1
Sequence:CCGGAGGAAATCTGAAGACGATAAACTCGAGTTTATCGTCTTCAGATTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018237.2-2264s21c1
Sequence:CCGGGCGTCGAGAAAGAAGATATATCTCGAGATATATCTTCTTTCTCGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018237.2-1675s21c1
Sequence:CCGGTGTTGATTAAGACTGCTATTCCTCGAGGAATAGCAGTCTTAATCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018237
VALIDATED
CCAR1 MISSION shRNA Lentiviral Transduction Particles
cell division cycle and apoptosis regulator 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018237.1-351s1c1
Sequence:CCGGGCTGCATTACAACAGCAATATCTCGAGATATTGCTGTTGTAATGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018237.1-3104s1c1
Sequence:CCGGGCAGGAAGATATGCTAGGAAACTCGAGTTTCCTAGCATATCTTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018237.1-234s1c1
Sequence:CCGGCCTACCATTTATACACAGCAACTCGAGTTGCTGTGTATAAATGGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018237.1-879s1c1
Sequence:CCGGGCAGCTTCTATTACACCACTACTCGAGTAGTGGTGTAATAGAAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018237.1-1480s1c1
Sequence:CCGGGCCCTAGTATGGAAGATTTATCTCGAGATAAATCTTCCATACTAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018237.2-224s21c1
Sequence:CCGGTGGAGCATCTCCTACCATTTACTCGAGTAAATGGTAGGAGATGCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018237.2-1433s21c1
Sequence:CCGGACCAGATGCTGACCACTTATACTCGAGTATAAGTGGTCAGCATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018237.2-677s21c1
Sequence:CCGGATTGGTTGAAGCTACTTATAACTCGAGTTATAAGTAGCTTCAACCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018237.2-907s21c1
Sequence:CCGGCTCAACCACAGCCCTTATTACCTCGAGGTAATAAGGGCTGTGGTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018237.2-2202s21c1
Sequence:CCGGAGGAAATCTGAAGACGATAAACTCGAGTTTATCGTCTTCAGATTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018237.2-2264s21c1
Sequence:CCGGGCGTCGAGAAAGAAGATATATCTCGAGATATATCTTCTTTCTCGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018237.2-1675s21c1
Sequence:CCGGTGTTGATTAAGACTGCTATTCCTCGAGGAATAGCAGTCTTAATCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026201
VALIDATED
CCAR1 MISSION shRNA Bacterial Glycerol Stock
cell division cycle and apoptosis regulator 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000177997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026201.1-1230s1c1
Sequence:CCGGGCGCCGTTATCAGAACTTATACTCGAGTATAAGTTCTGATAACGGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026201.1-3424s1c1
Sequence:CCGGCTCAGAAACTTATCTACAGTTCTCGAGAACTGTAGATAAGTTTCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026201.1-552s1c1
Sequence:CCGGGCTACATGATACATTTGGATTCTCGAGAATCCAAATGTATCATGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026201.1-2229s1c1
Sequence:CCGGGCGTCAAGAAAGAAGATACATCTCGAGATGTATCTTCTTTCTTGACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177314    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026201.1-3553s1c1
Sequence:CCGGGAGTGTGTTAATAGTGTACTACTCGAGTAGTACACTATTAACACACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026201.1-1447s1c1
Sequence:CCGGCCTAGTATGGAAGACTTGTATCTCGAGATACAAGTCTTCCATACTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177577    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026201.1-3701s1c1
Sequence:CCGGCCTGTAATTTCTAGCATTCAACTCGAGTTGAATGCTAGAAATTACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026201.1-263s1c1
Sequence:CCGGCGCCAGCAAACTATCAGTTAACTCGAGTTAACTGATAGTTTGCTGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198054    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026201.1-2077s1c1
Sequence:CCGGCGCCTAACAAAGCAGCTTAAACTCGAGTTTAAGCTGCTTTGTTAGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197552    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026201.1-3615s1c1
Sequence:CCGGCATGCTTGACTTTAGTAGTATCTCGAGATACTACTAAAGTCAAGCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026201
VALIDATED
CCAR1 MISSION shRNA shRNA Plasmid DNA
cell division cycle and apoptosis regulator 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000177997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026201.1-1230s1c1
Sequence:CCGGGCGCCGTTATCAGAACTTATACTCGAGTATAAGTTCTGATAACGGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026201.1-3424s1c1
Sequence:CCGGCTCAGAAACTTATCTACAGTTCTCGAGAACTGTAGATAAGTTTCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026201.1-552s1c1
Sequence:CCGGGCTACATGATACATTTGGATTCTCGAGAATCCAAATGTATCATGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026201.1-2229s1c1
Sequence:CCGGGCGTCAAGAAAGAAGATACATCTCGAGATGTATCTTCTTTCTTGACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177314    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026201.1-3553s1c1
Sequence:CCGGGAGTGTGTTAATAGTGTACTACTCGAGTAGTACACTATTAACACACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026201.1-1447s1c1
Sequence:CCGGCCTAGTATGGAAGACTTGTATCTCGAGATACAAGTCTTCCATACTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177577    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026201.1-3701s1c1
Sequence:CCGGCCTGTAATTTCTAGCATTCAACTCGAGTTGAATGCTAGAAATTACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026201.1-263s1c1
Sequence:CCGGCGCCAGCAAACTATCAGTTAACTCGAGTTAACTGATAGTTTGCTGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198054    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026201.1-2077s1c1
Sequence:CCGGCGCCTAACAAAGCAGCTTAAACTCGAGTTTAAGCTGCTTTGTTAGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197552    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026201.1-3615s1c1
Sequence:CCGGCATGCTTGACTTTAGTAGTATCTCGAGATACTACTAAAGTCAAGCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026201
VALIDATED
CCAR1 MISSION shRNA Lentiviral Transduction Particles
cell division cycle and apoptosis regulator 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000177997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026201.1-1230s1c1
Sequence:CCGGGCGCCGTTATCAGAACTTATACTCGAGTATAAGTTCTGATAACGGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026201.1-3424s1c1
Sequence:CCGGCTCAGAAACTTATCTACAGTTCTCGAGAACTGTAGATAAGTTTCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026201.1-552s1c1
Sequence:CCGGGCTACATGATACATTTGGATTCTCGAGAATCCAAATGTATCATGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026201.1-2229s1c1
Sequence:CCGGGCGTCAAGAAAGAAGATACATCTCGAGATGTATCTTCTTTCTTGACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177314    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026201.1-3553s1c1
Sequence:CCGGGAGTGTGTTAATAGTGTACTACTCGAGTAGTACACTATTAACACACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026201.1-1447s1c1
Sequence:CCGGCCTAGTATGGAAGACTTGTATCTCGAGATACAAGTCTTCCATACTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177577    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026201.1-3701s1c1
Sequence:CCGGCCTGTAATTTCTAGCATTCAACTCGAGTTGAATGCTAGAAATTACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026201.1-263s1c1
Sequence:CCGGCGCCAGCAAACTATCAGTTAACTCGAGTTAACTGATAGTTTGCTGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198054    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026201.1-2077s1c1
Sequence:CCGGCGCCTAACAAAGCAGCTTAAACTCGAGTTTAAGCTGCTTTGTTAGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197552    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026201.1-3615s1c1
Sequence:CCGGCATGCTTGACTTTAGTAGTATCTCGAGATACTACTAAAGTCAAGCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)