EMAIL THIS PAGE TO A FRIEND

CCDC127

coiled-coil domain containing 127

46 Gene Product Result for
UniProtKB ID: Q96BQ5
Gene ID:
Mouse(67433) coiled-coil domain containing 127
Rat(308060) coiled-coil domain containing 127
naked mole-rat(101697224) coiled-coil domain containing 127
domestic guinea pig(100716681) coiled-coil domain containing 127
sheep(101102759) coiled-coil domain containing 127
chicken(420970) coiled-coil domain containing 127
cow(100125239) coiled-coil domain containing 127
domestic cat(101097133) coiled-coil domain containing 127
dog(100684488) coiled-coil domain containing 127
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145265 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145265 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145265 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024201 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024201 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024201 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145265 Rosetta Predictions human pricing
NM_198766 Rosetta Predictions rat pricing
NM_024201 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145265 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047560 predicted 501
2 SASI_Hs01_00047561 predicted 727
3 SASI_Hs01_00047562 predicted 716
4 SASI_Hs01_00047563 predicted 726
5 SASI_Hs01_00047564 predicted 749
6 SASI_Hs02_00365134 predicted 631
7 SASI_Hs01_00047565 predicted 1126
8 SASI_Hs01_00047567 predicted 306
9 SASI_Hs01_00047568 predicted 816
10 SASI_Hs01_00047569 predicted 783
11 SASI_Hs01_00047566 predicted 797
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198766 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034951 predicted 291
2 SASI_Rn01_00034952 predicted 714
3 SASI_Rn01_00034953 predicted 791
4 SASI_Rn01_00034954 predicted 721
5 SASI_Rn01_00034955 predicted 577
6 SASI_Rn01_00034956 predicted 516
7 SASI_Rn01_00034957 predicted 710
8 SASI_Rn01_00034958 predicted 757
9 SASI_Rn01_00034960 predicted 795
10 SASI_Rn02_00270009 predicted 811
11 SASI_Rn01_00034959 predicted 760
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024201 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327547 predicted 1069
2 SASI_Mm02_00327548 predicted 538
3 SASI_Mm02_00327549 predicted 774
4 SASI_Mm02_00327550 predicted 775
5 SASI_Mm02_00327551 predicted 770
6 SASI_Mm02_00327552 predicted 688
7 SASI_Mm02_00327553 predicted 1030
8 SASI_Mm02_00327554 predicted 1127
9 SASI_Mm02_00327555 predicted 1024
10 SASI_Mm02_00327556 predicted 1132
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145265
VALIDATED
CCDC127 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 127
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_145265.2-1140s1c1
Sequence:CCGGGCAGAACAGTATAACCTCGTACTCGAGTACGAGGTTATACTGTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145265.2-830s1c1
Sequence:CCGGGTTGTCGAACTGAAGAAGTTTCTCGAGAAACTTCTTCAGTTCGACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145265.2-839s1c1
Sequence:CCGGCTGAAGAAGTTTAAGAGAGTACTCGAGTACTCTCTTAAACTTCTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166986    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145265.2-743s1c1
Sequence:CCGGCATGATACATACTGTGGTGATCTCGAGATCACCACAGTATGTATCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145265.2-610s1c1
Sequence:CCGGGAATATCTACTGCAGTCTGTTCTCGAGAACAGACTGCAGTAGATATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145265.2-429s1c1
Sequence:CCGGGACGCAAGTTGGTAGAAGAAACTCGAGTTTCTTCTACCAACTTGCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_145265.2-519s1c1
Sequence:CCGGCGTATTTGAGCTGCCTGCAAACTCGAGTTTGCAGGCAGCTCAAATACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145265.2-400s21c1
Sequence:CCGGTAGTTACCGAGAAGCCCTTATCTCGAGATAAGGGCTTCTCGGTAACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145265.2-505s21c1
Sequence:CCGGGCCTTTGAGAAGTGCGTATTTCTCGAGAAATACGCACTTCTCAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145265.2-719s21c1
Sequence:CCGGGCCGGTCTCACCGACATATTTCTCGAGAAATATGTCGGTGAGACCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145265.2-586s21c1
Sequence:CCGGTGAAGCTGTTCTCACAGAAAGCTCGAGCTTTCTGTGAGAACAGCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145265.2-798s21c1
Sequence:CCGGTCATGTGGCTCTATCTCAAATCTCGAGATTTGAGATAGAGCCACATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145265.2-771s21c1
Sequence:CCGGACACCAACAAACGCCAGAATGCTCGAGCATTCTGGCGTTTGTTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145265
VALIDATED
CCDC127 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 127
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_145265.2-1140s1c1
Sequence:CCGGGCAGAACAGTATAACCTCGTACTCGAGTACGAGGTTATACTGTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145265.2-830s1c1
Sequence:CCGGGTTGTCGAACTGAAGAAGTTTCTCGAGAAACTTCTTCAGTTCGACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145265.2-839s1c1
Sequence:CCGGCTGAAGAAGTTTAAGAGAGTACTCGAGTACTCTCTTAAACTTCTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166986    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145265.2-743s1c1
Sequence:CCGGCATGATACATACTGTGGTGATCTCGAGATCACCACAGTATGTATCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145265.2-610s1c1
Sequence:CCGGGAATATCTACTGCAGTCTGTTCTCGAGAACAGACTGCAGTAGATATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145265.2-429s1c1
Sequence:CCGGGACGCAAGTTGGTAGAAGAAACTCGAGTTTCTTCTACCAACTTGCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_145265.2-519s1c1
Sequence:CCGGCGTATTTGAGCTGCCTGCAAACTCGAGTTTGCAGGCAGCTCAAATACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145265.2-400s21c1
Sequence:CCGGTAGTTACCGAGAAGCCCTTATCTCGAGATAAGGGCTTCTCGGTAACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145265.2-505s21c1
Sequence:CCGGGCCTTTGAGAAGTGCGTATTTCTCGAGAAATACGCACTTCTCAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145265.2-719s21c1
Sequence:CCGGGCCGGTCTCACCGACATATTTCTCGAGAAATATGTCGGTGAGACCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145265.2-586s21c1
Sequence:CCGGTGAAGCTGTTCTCACAGAAAGCTCGAGCTTTCTGTGAGAACAGCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145265.2-798s21c1
Sequence:CCGGTCATGTGGCTCTATCTCAAATCTCGAGATTTGAGATAGAGCCACATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145265.2-771s21c1
Sequence:CCGGACACCAACAAACGCCAGAATGCTCGAGCATTCTGGCGTTTGTTGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145265
VALIDATED
CCDC127 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 127
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_145265.2-1140s1c1
Sequence:CCGGGCAGAACAGTATAACCTCGTACTCGAGTACGAGGTTATACTGTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145265.2-830s1c1
Sequence:CCGGGTTGTCGAACTGAAGAAGTTTCTCGAGAAACTTCTTCAGTTCGACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145265.2-839s1c1
Sequence:CCGGCTGAAGAAGTTTAAGAGAGTACTCGAGTACTCTCTTAAACTTCTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166986    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145265.2-743s1c1
Sequence:CCGGCATGATACATACTGTGGTGATCTCGAGATCACCACAGTATGTATCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145265.2-610s1c1
Sequence:CCGGGAATATCTACTGCAGTCTGTTCTCGAGAACAGACTGCAGTAGATATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145265.2-429s1c1
Sequence:CCGGGACGCAAGTTGGTAGAAGAAACTCGAGTTTCTTCTACCAACTTGCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_145265.2-519s1c1
Sequence:CCGGCGTATTTGAGCTGCCTGCAAACTCGAGTTTGCAGGCAGCTCAAATACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145265.2-400s21c1
Sequence:CCGGTAGTTACCGAGAAGCCCTTATCTCGAGATAAGGGCTTCTCGGTAACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145265.2-505s21c1
Sequence:CCGGGCCTTTGAGAAGTGCGTATTTCTCGAGAAATACGCACTTCTCAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145265.2-719s21c1
Sequence:CCGGGCCGGTCTCACCGACATATTTCTCGAGAAATATGTCGGTGAGACCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145265.2-586s21c1
Sequence:CCGGTGAAGCTGTTCTCACAGAAAGCTCGAGCTTTCTGTGAGAACAGCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145265.2-798s21c1
Sequence:CCGGTCATGTGGCTCTATCTCAAATCTCGAGATTTGAGATAGAGCCACATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145265.2-771s21c1
Sequence:CCGGACACCAACAAACGCCAGAATGCTCGAGCATTCTGGCGTTTGTTGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024201
VALIDATED
CCDC127 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 127
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200082    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024201.2-2591s1c1
Sequence:CCGGCCCGCTTCCTATTCCACATTTCTCGAGAAATGTGGAATAGGAAGCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024201.2-778s1c1
Sequence:CCGGGAACTACTTGTCGAACTTAAACTCGAGTTTAAGTTCGACAAGTAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198615    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024201.2-2592s1c1
Sequence:CCGGCCGCTTCCTATTCCACATTTACTCGAGTAAATGTGGAATAGGAAGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024201.2-125s1c1
Sequence:CCGGGCAAGTGGAATTATGCCCTATCTCGAGATAGGGCATAATTCCACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176774    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024201.2-1329s1c1
Sequence:CCGGCCTGTATTCAATAAGCATGTTCTCGAGAACATGCTTATTGAATACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024201.2-811s1c1
Sequence:CCGGGTAGAGAAGGTCATATTAGAACTCGAGTTCTAATATGACCTTCTCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024201.2-750s1c1
Sequence:CCGGGCTCATGTGGATGTATCTCAACTCGAGTTGAGATACATCCACATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024201.2-1666s1c1
Sequence:CCGGGCTGTGATTACAAGTGTGTATCTCGAGATACACACTTGTAATCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024201.2-1329s21c1
Sequence:CCGGCCTGTATTCAATAAGCATGTTCTCGAGAACATGCTTATTGAATACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024201.2-126s21c1
Sequence:CCGGCAAGTGGAATTATGCCCTATTCTCGAGAATAGGGCATAATTCCACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024201.2-164s21c1
Sequence:CCGGTGGCAGCATTTCGTTGGATTTCTCGAGAAATCCAACGAAATGCTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024201.2-807s21c1
Sequence:CCGGGAAAGTAGAGAAGGTCATATTCTCGAGAATATGACCTTCTCTACTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024201.2-777s21c1
Sequence:CCGGGGAACTACTTGTCGAACTTAACTCGAGTTAAGTTCGACAAGTAGTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024201
VALIDATED
CCDC127 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 127
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200082    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024201.2-2591s1c1
Sequence:CCGGCCCGCTTCCTATTCCACATTTCTCGAGAAATGTGGAATAGGAAGCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024201.2-778s1c1
Sequence:CCGGGAACTACTTGTCGAACTTAAACTCGAGTTTAAGTTCGACAAGTAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198615    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024201.2-2592s1c1
Sequence:CCGGCCGCTTCCTATTCCACATTTACTCGAGTAAATGTGGAATAGGAAGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024201.2-125s1c1
Sequence:CCGGGCAAGTGGAATTATGCCCTATCTCGAGATAGGGCATAATTCCACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176774    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024201.2-1329s1c1
Sequence:CCGGCCTGTATTCAATAAGCATGTTCTCGAGAACATGCTTATTGAATACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024201.2-811s1c1
Sequence:CCGGGTAGAGAAGGTCATATTAGAACTCGAGTTCTAATATGACCTTCTCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024201.2-750s1c1
Sequence:CCGGGCTCATGTGGATGTATCTCAACTCGAGTTGAGATACATCCACATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024201.2-1666s1c1
Sequence:CCGGGCTGTGATTACAAGTGTGTATCTCGAGATACACACTTGTAATCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024201.2-1329s21c1
Sequence:CCGGCCTGTATTCAATAAGCATGTTCTCGAGAACATGCTTATTGAATACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024201.2-126s21c1
Sequence:CCGGCAAGTGGAATTATGCCCTATTCTCGAGAATAGGGCATAATTCCACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024201.2-164s21c1
Sequence:CCGGTGGCAGCATTTCGTTGGATTTCTCGAGAAATCCAACGAAATGCTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024201.2-807s21c1
Sequence:CCGGGAAAGTAGAGAAGGTCATATTCTCGAGAATATGACCTTCTCTACTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024201.2-777s21c1
Sequence:CCGGGGAACTACTTGTCGAACTTAACTCGAGTTAAGTTCGACAAGTAGTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024201
VALIDATED
CCDC127 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 127
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200082    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024201.2-2591s1c1
Sequence:CCGGCCCGCTTCCTATTCCACATTTCTCGAGAAATGTGGAATAGGAAGCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024201.2-778s1c1
Sequence:CCGGGAACTACTTGTCGAACTTAAACTCGAGTTTAAGTTCGACAAGTAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198615    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024201.2-2592s1c1
Sequence:CCGGCCGCTTCCTATTCCACATTTACTCGAGTAAATGTGGAATAGGAAGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024201.2-125s1c1
Sequence:CCGGGCAAGTGGAATTATGCCCTATCTCGAGATAGGGCATAATTCCACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176774    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024201.2-1329s1c1
Sequence:CCGGCCTGTATTCAATAAGCATGTTCTCGAGAACATGCTTATTGAATACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024201.2-811s1c1
Sequence:CCGGGTAGAGAAGGTCATATTAGAACTCGAGTTCTAATATGACCTTCTCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024201.2-750s1c1
Sequence:CCGGGCTCATGTGGATGTATCTCAACTCGAGTTGAGATACATCCACATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024201.2-1666s1c1
Sequence:CCGGGCTGTGATTACAAGTGTGTATCTCGAGATACACACTTGTAATCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024201.2-1329s21c1
Sequence:CCGGCCTGTATTCAATAAGCATGTTCTCGAGAACATGCTTATTGAATACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024201.2-126s21c1
Sequence:CCGGCAAGTGGAATTATGCCCTATTCTCGAGAATAGGGCATAATTCCACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024201.2-164s21c1
Sequence:CCGGTGGCAGCATTTCGTTGGATTTCTCGAGAAATCCAACGAAATGCTGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024201.2-807s21c1
Sequence:CCGGGAAAGTAGAGAAGGTCATATTCTCGAGAATATGACCTTCTCTACTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024201.2-777s21c1
Sequence:CCGGGGAACTACTTGTCGAACTTAACTCGAGTTAAGTTCGACAAGTAGTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)