EMAIL THIS PAGE TO A FRIEND

CCDC138

coiled-coil domain containing 138

83 Gene Product Result for
UniProtKB ID: Q96M89, Q05DF1, Q4ZG07, Q53TE1, Q6ZUY5, Q86VL7
Gene ID:
Mouse(76138) coiled-coil domain containing 138
Rat(499442) coiled-coil domain containing 138
dog(610991) coiled-coil domain containing 138
cow(507644) coiled-coil domain containing 138
domestic cat(101093595) coiled-coil domain containing 138
sheep(101109087) coiled-coil domain containing 138
Domestic Rabbit(100339884) coiled-coil domain containing 138
domestic guinea pig(100712652) coiled-coil domain containing 138
naked mole-rat(101699665) coiled-coil domain containing 138
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001162956 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001162956 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001162956 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144978 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144978 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144978 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144978 Rosetta Predictions human pricing
XM_001053950 Rosetta Predictions rat pricing
XM_574765 Rosetta Predictions rat pricing
XR_001533 Rosetta Predictions mouse pricing
XR_001535 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144978 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364781 predicted 816
2 SASI_Hs01_00163664 predicted 881
3 SASI_Hs02_00364782 predicted 1734
4 SASI_Hs01_00163665 predicted 1185
5 SASI_Hs01_00163666 predicted 264
6 SASI_Hs01_00163667 predicted 1677
7 SASI_Hs01_00163669 predicted 1089
8 SASI_Hs01_00163671 predicted 969
9 SASI_Hs01_00163672 predicted 577
10 SASI_Hs01_00163673 predicted 234
11 SASI_Hs01_00163668 predicted 374
12 SASI_Hs01_00163670 predicted 1690
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053950 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00274130 predicted 743
2 SASI_Rn02_00274131 predicted 762
3 SASI_Rn02_00274132 predicted 1388
4 SASI_Rn02_00274133 predicted 1045
5 SASI_Rn02_00274134 predicted 1636
6 SASI_Rn02_00274135 predicted 669
7 SASI_Rn02_00274136 predicted 1601
8 SASI_Rn02_00274137 predicted 328
9 SASI_Rn02_00274138 predicted 1250
10 SASI_Rn02_00274139 predicted 1325
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574765 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402530 predicted 747
2 SASI_Rn02_00402531 predicted 757
3 SASI_Rn02_00402532 predicted 1386
4 SASI_Rn02_00402533 predicted 1044
5 SASI_Rn02_00402534 predicted 1636
6 SASI_Rn02_00402535 predicted 668
7 SASI_Rn02_00402536 predicted 1601
8 SASI_Rn02_00402537 predicted 334
9 SASI_Rn02_00402538 predicted 1252
10 SASI_Rn02_00402539 predicted 1325
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_001533 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00451907 predicted 1590
2 SASI_Mm02_00451908 predicted 1438
3 SASI_Mm02_00451909 predicted 1117
4 SASI_Mm02_00451910 predicted 1796
5 SASI_Mm02_00451911 predicted 772
6 SASI_Mm02_00451912 predicted 738
7 SASI_Mm02_00451913 predicted 832
8 SASI_Mm02_00451914 predicted 1668
9 SASI_Mm02_00451915 predicted 1490
10 SASI_Mm02_00451916 predicted 677
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_001535 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00451927 predicted 1593
2 SASI_Mm02_00451928 predicted 1434
3 SASI_Mm02_00451929 predicted 1123
4 SASI_Mm02_00451930 predicted 1791
5 SASI_Mm02_00451931 predicted 775
6 SASI_Mm02_00451932 predicted 736
7 SASI_Mm02_00451933 predicted 837
8 SASI_Mm02_00451934 predicted 1666
9 SASI_Mm02_00451935 predicted 1488
10 SASI_Mm02_00451936 predicted 668
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001162956
CCDC138 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 138
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000347145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162956.1-814s21c1
Sequence:CCGGGAGCAACATGGTACGGAAATTCTCGAGAATTTCCGTACCATGTTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162956.1-1343s21c1
Sequence:CCGGACGAGCCGTTCGTAAGGTTTACTCGAGTAAACCTTACGAACGGCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001162956.1-2275s21c1
Sequence:CCGGTGTTTCAGTTTAAGGTAATACCTCGAGGTATTACCTTAAACTGAAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162956.1-1393s21c1
Sequence:CCGGAGCGCACGGCAATCAACTATGCTCGAGCATAGTTGATTGCCGTGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162956.1-1551s21c1
Sequence:CCGGGAGATTCTTATCAACCTTAATCTCGAGATTAAGGTTGATAAGAATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001162956
CCDC138 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 138
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000347145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162956.1-814s21c1
Sequence:CCGGGAGCAACATGGTACGGAAATTCTCGAGAATTTCCGTACCATGTTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162956.1-1343s21c1
Sequence:CCGGACGAGCCGTTCGTAAGGTTTACTCGAGTAAACCTTACGAACGGCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001162956.1-2275s21c1
Sequence:CCGGTGTTTCAGTTTAAGGTAATACCTCGAGGTATTACCTTAAACTGAAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162956.1-1393s21c1
Sequence:CCGGAGCGCACGGCAATCAACTATGCTCGAGCATAGTTGATTGCCGTGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162956.1-1551s21c1
Sequence:CCGGGAGATTCTTATCAACCTTAATCTCGAGATTAAGGTTGATAAGAATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001162956
CCDC138 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 138
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000347145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162956.1-814s21c1
Sequence:CCGGGAGCAACATGGTACGGAAATTCTCGAGAATTTCCGTACCATGTTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162956.1-1343s21c1
Sequence:CCGGACGAGCCGTTCGTAAGGTTTACTCGAGTAAACCTTACGAACGGCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001162956.1-2275s21c1
Sequence:CCGGTGTTTCAGTTTAAGGTAATACCTCGAGGTATTACCTTAAACTGAAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162956.1-1393s21c1
Sequence:CCGGAGCGCACGGCAATCAACTATGCTCGAGCATAGTTGATTGCCGTGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162956.1-1551s21c1
Sequence:CCGGGAGATTCTTATCAACCTTAATCTCGAGATTAAGGTTGATAAGAATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144978
CCDC138 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 138
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144978.1-556s1c1
Sequence:CCGGGCATCAGACAAGCGGAGTTTACTCGAGTAAACTCCGCTTGTCTGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144978.1-458s1c1
Sequence:CCGGCCTTGCCAACTAATACGACCTCTCGAGAGGTCGTATTAGTTGGCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144978.1-1456s1c1
Sequence:CCGGCAGGATAATTCTCCACAGCATCTCGAGATGCTGTGGAGAATTATCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144978.1-752s1c1
Sequence:CCGGGTGTTGAAGAAGAGGTTCTTACTCGAGTAAGAACCTCTTCTTCAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144978.1-1966s1c1
Sequence:CCGGGAGCATGCATTTCTCTGTATTCTCGAGAATACAGAGAAATGCATGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135641    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144978.1-814s1c1
Sequence:CCGGGAACACTTAACCGAAGTTCTTCTCGAGAAGAACTTCGGTTAAGTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144978.1-230s1c1
Sequence:CCGGCTGGAGATAAAGTTGGTTCATCTCGAGATGAACCAACTTTATCTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144978.1-310s1c1
Sequence:CCGGCACGTAAATGTGAATTGCCTACTCGAGTAGGCAATTCACATTTACGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144978.1-272s1c1
Sequence:CCGGGCAAGCATTGTAGAACACCATCTCGAGATGGTGTTCTACAATGCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144978.1-1147s1c1
Sequence:CCGGGACTGGATTTCGGATCATCATCTCGAGATGATGATCCGAAATCCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144978
CCDC138 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 138
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144978.1-556s1c1
Sequence:CCGGGCATCAGACAAGCGGAGTTTACTCGAGTAAACTCCGCTTGTCTGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144978.1-458s1c1
Sequence:CCGGCCTTGCCAACTAATACGACCTCTCGAGAGGTCGTATTAGTTGGCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144978.1-1456s1c1
Sequence:CCGGCAGGATAATTCTCCACAGCATCTCGAGATGCTGTGGAGAATTATCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144978.1-752s1c1
Sequence:CCGGGTGTTGAAGAAGAGGTTCTTACTCGAGTAAGAACCTCTTCTTCAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144978.1-1966s1c1
Sequence:CCGGGAGCATGCATTTCTCTGTATTCTCGAGAATACAGAGAAATGCATGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135641    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144978.1-814s1c1
Sequence:CCGGGAACACTTAACCGAAGTTCTTCTCGAGAAGAACTTCGGTTAAGTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144978.1-230s1c1
Sequence:CCGGCTGGAGATAAAGTTGGTTCATCTCGAGATGAACCAACTTTATCTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144978.1-310s1c1
Sequence:CCGGCACGTAAATGTGAATTGCCTACTCGAGTAGGCAATTCACATTTACGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144978.1-272s1c1
Sequence:CCGGGCAAGCATTGTAGAACACCATCTCGAGATGGTGTTCTACAATGCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144978.1-1147s1c1
Sequence:CCGGGACTGGATTTCGGATCATCATCTCGAGATGATGATCCGAAATCCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144978
CCDC138 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 138
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144978.1-556s1c1
Sequence:CCGGGCATCAGACAAGCGGAGTTTACTCGAGTAAACTCCGCTTGTCTGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144978.1-458s1c1
Sequence:CCGGCCTTGCCAACTAATACGACCTCTCGAGAGGTCGTATTAGTTGGCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144978.1-1456s1c1
Sequence:CCGGCAGGATAATTCTCCACAGCATCTCGAGATGCTGTGGAGAATTATCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144978.1-752s1c1
Sequence:CCGGGTGTTGAAGAAGAGGTTCTTACTCGAGTAAGAACCTCTTCTTCAACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144978.1-1966s1c1
Sequence:CCGGGAGCATGCATTTCTCTGTATTCTCGAGAATACAGAGAAATGCATGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135641    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144978.1-814s1c1
Sequence:CCGGGAACACTTAACCGAAGTTCTTCTCGAGAAGAACTTCGGTTAAGTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144978.1-230s1c1
Sequence:CCGGCTGGAGATAAAGTTGGTTCATCTCGAGATGAACCAACTTTATCTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144978.1-310s1c1
Sequence:CCGGCACGTAAATGTGAATTGCCTACTCGAGTAGGCAATTCACATTTACGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144978.1-272s1c1
Sequence:CCGGGCAAGCATTGTAGAACACCATCTCGAGATGGTGTTCTACAATGCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144978.1-1147s1c1
Sequence:CCGGGACTGGATTTCGGATCATCATCTCGAGATGATGATCCGAAATCCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)