EMAIL THIS PAGE TO A FRIEND

CCDC153

coiled-coil domain containing 153

81 Gene Product Result for
UniProtKB ID: Q494R4
Gene ID:
Mouse(270150) coiled-coil domain containing 153
Rat(300663) coiled-coil domain containing 153
Zebrafish(792470) coiled-coil domain containing 153
cow(508592) coiled-coil domain containing 153
domestic cat(101084901) coiled-coil domain containing 153
dog(100683773) coiled-coil domain containing 153
chicken(769857) coiled-coil domain containing 153
naked mole-rat(101708702) coiled-coil domain containing 153
domestic guinea pig(100718501) coiled-coil domain containing 153
sheep(101115156) coiled-coil domain containing 153
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033658 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001033658 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001033658 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081369 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081369 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081369 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU103261 MISSION® esiRNA esiRNA human CCDC153 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033658 Rosetta Predictions human pricing
NM_001013953 Rosetta Predictions rat pricing
NM_001081369 Rosetta Predictions mouse pricing
XM_196478 Rosetta Predictions mouse pricing
XM_901245 Rosetta Predictions mouse pricing
XM_901248 Rosetta Predictions mouse pricing
XM_901252 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033658 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140087 predicted 337
2 SASI_Hs01_00140088 predicted 339
3 SASI_Hs01_00140089 predicted 230
4 SASI_Hs01_00140090 predicted 301
5 SASI_Hs01_00140091 predicted 340
6 SASI_Hs01_00140092 predicted 234
7 SASI_Hs01_00140093 predicted 299
8 SASI_Hs01_00140094 predicted 335
9 SASI_Hs01_00140095 predicted 389
10 SASI_Hs01_00140096 predicted 377
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013953 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035990 predicted 1035
2 SASI_Rn01_00035991 predicted 1061
3 SASI_Rn01_00035992 predicted 932
4 SASI_Rn01_00035993 predicted 977
5 SASI_Rn01_00035994 predicted 1068
6 SASI_Rn01_00035995 predicted 495
7 SASI_Rn01_00035996 predicted 1032
8 SASI_Rn01_00035997 predicted 641
9 SASI_Rn01_00035998 predicted 880
10 SASI_Rn01_00035999 predicted 941
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081369 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297741 predicted 403
2 SASI_Mm02_00297742 predicted 374
3 SASI_Mm02_00297743 predicted 342
4 SASI_Mm02_00297744 predicted 299
5 SASI_Mm02_00297745 predicted 371
6 SASI_Mm02_00297746 predicted 375
7 SASI_Mm02_00297747 predicted 345
8 SASI_Mm02_00297748 predicted 428
9 SASI_Mm02_00297749 predicted 447
10 SASI_Mm02_00297750 predicted 453
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_196478 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00284526 predicted 1005
2 SASI_Mm01_00284527 predicted 1042
3 SASI_Mm01_00284528 predicted 1014
4 SASI_Mm01_00284529 predicted 1007
5 SASI_Mm01_00284530 predicted 1045
6 SASI_Mm01_00284531 predicted 1045
7 SASI_Mm01_00284532 predicted 1037
8 SASI_Mm01_00284533 predicted 1013
9 SASI_Mm01_00284534 predicted 1019
10 SASI_Mm01_00284535 predicted 1040
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901245 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00227139 predicted 407
2 SASI_Mm01_00227140 predicted 387
3 SASI_Mm01_00227141 predicted 346
4 SASI_Mm01_00227142 predicted 311
5 SASI_Mm01_00227143 predicted 381
6 SASI_Mm01_00227144 predicted 380
7 SASI_Mm01_00227145 predicted 359
8 SASI_Mm01_00227146 predicted 433
9 SASI_Mm01_00227147 predicted 446
10 SASI_Mm01_00227148 predicted 456
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901248 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00207111 predicted 522
2 SASI_Mm01_00207112 predicted 446
3 SASI_Mm01_00207113 predicted 567
4 SASI_Mm01_00207114 predicted 520
5 SASI_Mm01_00207115 predicted 676
6 SASI_Mm01_00207116 predicted 436
7 SASI_Mm01_00207117 predicted 389
8 SASI_Mm01_00207118 predicted 323
9 SASI_Mm01_00207119 predicted 535
10 SASI_Mm01_00207120 predicted 403
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901252 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00283500 predicted 501
2 SASI_Mm01_00283501 predicted 483
3 SASI_Mm01_00283502 predicted 446
4 SASI_Mm01_00283503 predicted 407
5 SASI_Mm01_00283504 predicted 470
6 SASI_Mm01_00283505 predicted 479
7 SASI_Mm01_00283506 predicted 446
8 SASI_Mm01_00283507 predicted 530
9 SASI_Mm01_00283508 predicted 542
10 SASI_Mm01_00283509 predicted 549
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033658
CCDC153 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 153
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033658.1-304s21c1
Sequence:CCGGGCAGCTAGAGGCATGCCAAAGCTCGAGCTTTGGCATGCCTCTAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033658.1-442s21c1
Sequence:CCGGCGACAGTCTGGACAGGCTCTTCTCGAGAAGAGCCTGTCCAGACTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033658.1-251s21c1
Sequence:CCGGGATATGCAAACCCACAGCAAGCTCGAGCTTGCTGTGGGTTTGCATATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033658.1-420s21c1
Sequence:CCGGCGAAGTATGAGGAAATCTTACCTCGAGGTAAGATTTCCTCATACTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033658.1-281s21c1
Sequence:CCGGGAAGAAGTCAAAGGCCTTCGGCTCGAGCCGAAGGCCTTTGACTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033658
CCDC153 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 153
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033658.1-304s21c1
Sequence:CCGGGCAGCTAGAGGCATGCCAAAGCTCGAGCTTTGGCATGCCTCTAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033658.1-442s21c1
Sequence:CCGGCGACAGTCTGGACAGGCTCTTCTCGAGAAGAGCCTGTCCAGACTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033658.1-251s21c1
Sequence:CCGGGATATGCAAACCCACAGCAAGCTCGAGCTTGCTGTGGGTTTGCATATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033658.1-420s21c1
Sequence:CCGGCGAAGTATGAGGAAATCTTACCTCGAGGTAAGATTTCCTCATACTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033658.1-281s21c1
Sequence:CCGGGAAGAAGTCAAAGGCCTTCGGCTCGAGCCGAAGGCCTTTGACTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033658
CCDC153 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 153
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033658.1-304s21c1
Sequence:CCGGGCAGCTAGAGGCATGCCAAAGCTCGAGCTTTGGCATGCCTCTAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033658.1-442s21c1
Sequence:CCGGCGACAGTCTGGACAGGCTCTTCTCGAGAAGAGCCTGTCCAGACTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033658.1-251s21c1
Sequence:CCGGGATATGCAAACCCACAGCAAGCTCGAGCTTGCTGTGGGTTTGCATATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033658.1-420s21c1
Sequence:CCGGCGAAGTATGAGGAAATCTTACCTCGAGGTAAGATTTCCTCATACTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033658.1-281s21c1
Sequence:CCGGGAAGAAGTCAAAGGCCTTCGGCTCGAGCCGAAGGCCTTTGACTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081369
CCDC153 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 153
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081369.2-622s21c1
Sequence:CCGGAGGAGCAACTGCGGCAATTTGCTCGAGCAAATTGCCGCAGTTGCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081369.2-720s21c1
Sequence:CCGGTCAATAGAACTATGGATTATGCTCGAGCATAATCCATAGTTCTATTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081369.2-289s21c1
Sequence:CCGGGTGAAGGGAAGGCCATATATGCTCGAGCATATATGGCCTTCCCTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081369.2-663s21c1
Sequence:CCGGTGAAACCGCTGGCCTCTAATCCTCGAGGATTAGAGGCCAGCGGTTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081369.2-501s21c1
Sequence:CCGGGCAGACATGGAGGCCAAATATCTCGAGATATTTGGCCTCCATGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081369
CCDC153 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 153
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081369.2-622s21c1
Sequence:CCGGAGGAGCAACTGCGGCAATTTGCTCGAGCAAATTGCCGCAGTTGCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081369.2-720s21c1
Sequence:CCGGTCAATAGAACTATGGATTATGCTCGAGCATAATCCATAGTTCTATTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081369.2-289s21c1
Sequence:CCGGGTGAAGGGAAGGCCATATATGCTCGAGCATATATGGCCTTCCCTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081369.2-663s21c1
Sequence:CCGGTGAAACCGCTGGCCTCTAATCCTCGAGGATTAGAGGCCAGCGGTTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081369.2-501s21c1
Sequence:CCGGGCAGACATGGAGGCCAAATATCTCGAGATATTTGGCCTCCATGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081369
CCDC153 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 153
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081369.2-622s21c1
Sequence:CCGGAGGAGCAACTGCGGCAATTTGCTCGAGCAAATTGCCGCAGTTGCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081369.2-720s21c1
Sequence:CCGGTCAATAGAACTATGGATTATGCTCGAGCATAATCCATAGTTCTATTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081369.2-289s21c1
Sequence:CCGGGTGAAGGGAAGGCCATATATGCTCGAGCATATATGGCCTTCCCTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081369.2-663s21c1
Sequence:CCGGTGAAACCGCTGGCCTCTAATCCTCGAGGATTAGAGGCCAGCGGTTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081369.2-501s21c1
Sequence:CCGGGCAGACATGGAGGCCAAATATCTCGAGATATTTGGCCTCCATGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)