EMAIL THIS PAGE TO A FRIEND

CCDC15

coiled-coil domain containing 15

98 Gene Product Result for
UniProtKB ID: Q0P6D6, Q9H8U7
Gene ID:
Mouse(245902) coiled-coil domain containing 15
Rat(367056) coiled-coil domain containing 15
chicken(419705) coiled-coil domain containing 15
cow(512305) coiled-coil domain containing 15
domestic cat(101085490) coiled-coil domain containing 15
dog(489304) coiled-coil domain containing 15
naked mole-rat(101707616) coiled-coil domain containing 15
domestic guinea pig(100720983) coiled-coil domain containing 15
sheep(101117460) coiled-coil domain containing 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025004 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025004 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025004 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081429 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081429 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081429 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025004 Rosetta Predictions human pricing
XM_001061074 Rosetta Predictions rat pricing
XM_345918 Rosetta Predictions rat pricing
NM_001081429 Rosetta Predictions mouse pricing
XM_900699 Rosetta Predictions mouse pricing
XM_991564 Rosetta Predictions mouse pricing
XM_991591 Rosetta Predictions mouse pricing
XM_991619 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025004 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226360 predicted 263
2 SASI_Hs02_00357662 predicted 2988
3 SASI_Hs01_00226362 predicted 1334
4 SASI_Hs02_00357663 predicted 1902
5 SASI_Hs01_00226364 predicted 282
6 SASI_Hs01_00226365 predicted 1498
7 SASI_Hs01_00226366 predicted 1322
8 SASI_Hs02_00357664 predicted 3118
9 SASI_Hs02_00357665 predicted 1987
10 SASI_Hs02_00357666 predicted 2166
11 SASI_Hs01_00226361 predicted 1309
12 SASI_Hs01_00226363 predicted 1637
13 SASI_Hs01_00226367 predicted 486
14 SASI_Hs01_00226368 predicted 1569
15 SASI_Hs01_00226369 predicted 535
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061074 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00298706 predicted 1812
2 SASI_Rn02_00298707 predicted 1756
3 SASI_Rn02_00298708 predicted 715
4 SASI_Rn02_00298709 predicted 2276
5 SASI_Rn02_00298710 predicted 708
6 SASI_Rn02_00298711 predicted 2152
7 SASI_Rn02_00298712 predicted 1639
8 SASI_Rn02_00298713 predicted 501
9 SASI_Rn02_00298714 predicted 1800
10 SASI_Rn02_00298715 predicted 286
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345918 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398882 predicted 1814
2 SASI_Rn02_00398883 predicted 1752
3 SASI_Rn02_00398884 predicted 713
4 SASI_Rn02_00398885 predicted 2277
5 SASI_Rn02_00398886 predicted 703
6 SASI_Rn02_00398887 predicted 2151
7 SASI_Rn02_00398888 predicted 1633
8 SASI_Rn02_00398889 predicted 498
9 SASI_Rn02_00398890 predicted 1806
10 SASI_Rn02_00398891 predicted 285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081429 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298291 predicted 1551
2 SASI_Mm02_00298292 predicted 1515
3 SASI_Mm02_00298293 predicted 1126
4 SASI_Mm02_00298294 predicted 2560
5 SASI_Mm02_00298295 predicted 1651
6 SASI_Mm02_00298296 predicted 2513
7 SASI_Mm02_00298297 predicted 1625
8 SASI_Mm02_00298298 predicted 421
9 SASI_Mm02_00298299 predicted 1255
10 SASI_Mm02_00298300 predicted 1730
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900699 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00281027 predicted 846
2 SASI_Mm01_00281028 predicted 1556
3 SASI_Mm01_00281029 predicted 1515
4 SASI_Mm01_00281030 predicted 1130
5 SASI_Mm01_00281031 predicted 1662
6 SASI_Mm01_00281032 predicted 1941
7 SASI_Mm01_00281033 predicted 1625
8 SASI_Mm01_00281034 predicted 1268
9 SASI_Mm01_00281035 predicted 1737
10 SASI_Mm01_00281036 predicted 724
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_991564 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00271240 predicted 501
2 SASI_Mm01_00271241 predicted 726
3 SASI_Mm01_00271242 predicted 673
4 SASI_Mm01_00271243 predicted 635
5 SASI_Mm01_00271244 predicted 526
6 SASI_Mm01_00271245 predicted 512
7 SASI_Mm01_00271246 predicted 676
8 SASI_Mm01_00271247 predicted 428
9 SASI_Mm01_00271248 predicted 730
10 SASI_Mm01_00271249 predicted 742
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_991591 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00229849 predicted 482
2 SASI_Mm01_00229850 predicted 496
3 SASI_Mm01_00229851 predicted 528
4 SASI_Mm01_00229852 predicted 694
5 SASI_Mm01_00229853 predicted 662
6 SASI_Mm01_00229854 predicted 754
7 SASI_Mm01_00229855 predicted 477
8 SASI_Mm01_00229856 predicted 733
9 SASI_Mm01_00229857 predicted 780
10 SASI_Mm01_00229858 predicted 338
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_991619 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00225409 predicted 2408
2 SASI_Mm01_00225410 predicted 1556
3 SASI_Mm01_00225411 predicted 1517
4 SASI_Mm01_00225412 predicted 1130
5 SASI_Mm01_00225413 predicted 2422
6 SASI_Mm01_00225414 predicted 2560
7 SASI_Mm01_00225415 predicted 1662
8 SASI_Mm01_00225416 predicted 2519
9 SASI_Mm01_00225417 predicted 1626
10 SASI_Mm01_00225418 predicted 1260
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025004
CCDC15 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 15
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025004.1-2018s1c1
Sequence:CCGGCCCAGAGACCAAGGTTATCTTCTCGAGAAGATAACCTTGGTCTCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025004.1-768s1c1
Sequence:CCGGCCCAGGCTCTTAGTGAAACTACTCGAGTAGTTTCACTAAGAGCCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025004.1-2336s1c1
Sequence:CCGGCCTCTGGACTATCATCAATATCTCGAGATATTGATGATAGTCCAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025004.1-1401s1c1
Sequence:CCGGGCCAGCCTATTAGGACAGAAACTCGAGTTTCTGTCCTAATAGGCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025004.2-2609s21c1
Sequence:CCGGATTGAGAGAGAACAAGTTAAACTCGAGTTTAACTTGTTCTCTCTCAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025004.2-2528s21c1
Sequence:CCGGTTTCAGTCTGACGTGGATAAACTCGAGTTTATCCACGTCAGACTGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025004.2-514s21c1
Sequence:CCGGACAAGTTAAATACCGAGTAAACTCGAGTTTACTCGGTATTTAACTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025004.2-2473s21c1
Sequence:CCGGGGCTTATGATAGGTATCAATCCTCGAGGATTGATACCTATCATAAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025004.2-938s21c1
Sequence:CCGGAGAGGAGAGTTGCCCATTAAGCTCGAGCTTAATGGGCAACTCTCCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025004
CCDC15 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 15
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025004.1-2018s1c1
Sequence:CCGGCCCAGAGACCAAGGTTATCTTCTCGAGAAGATAACCTTGGTCTCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025004.1-768s1c1
Sequence:CCGGCCCAGGCTCTTAGTGAAACTACTCGAGTAGTTTCACTAAGAGCCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025004.1-2336s1c1
Sequence:CCGGCCTCTGGACTATCATCAATATCTCGAGATATTGATGATAGTCCAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025004.1-1401s1c1
Sequence:CCGGGCCAGCCTATTAGGACAGAAACTCGAGTTTCTGTCCTAATAGGCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025004.2-2609s21c1
Sequence:CCGGATTGAGAGAGAACAAGTTAAACTCGAGTTTAACTTGTTCTCTCTCAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025004.2-2528s21c1
Sequence:CCGGTTTCAGTCTGACGTGGATAAACTCGAGTTTATCCACGTCAGACTGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025004.2-514s21c1
Sequence:CCGGACAAGTTAAATACCGAGTAAACTCGAGTTTACTCGGTATTTAACTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025004.2-2473s21c1
Sequence:CCGGGGCTTATGATAGGTATCAATCCTCGAGGATTGATACCTATCATAAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025004.2-938s21c1
Sequence:CCGGAGAGGAGAGTTGCCCATTAAGCTCGAGCTTAATGGGCAACTCTCCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025004
CCDC15 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 15
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025004.1-2018s1c1
Sequence:CCGGCCCAGAGACCAAGGTTATCTTCTCGAGAAGATAACCTTGGTCTCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025004.1-768s1c1
Sequence:CCGGCCCAGGCTCTTAGTGAAACTACTCGAGTAGTTTCACTAAGAGCCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025004.1-2336s1c1
Sequence:CCGGCCTCTGGACTATCATCAATATCTCGAGATATTGATGATAGTCCAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025004.1-1401s1c1
Sequence:CCGGGCCAGCCTATTAGGACAGAAACTCGAGTTTCTGTCCTAATAGGCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025004.2-2609s21c1
Sequence:CCGGATTGAGAGAGAACAAGTTAAACTCGAGTTTAACTTGTTCTCTCTCAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025004.2-2528s21c1
Sequence:CCGGTTTCAGTCTGACGTGGATAAACTCGAGTTTATCCACGTCAGACTGAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025004.2-514s21c1
Sequence:CCGGACAAGTTAAATACCGAGTAAACTCGAGTTTACTCGGTATTTAACTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025004.2-2473s21c1
Sequence:CCGGGGCTTATGATAGGTATCAATCCTCGAGGATTGATACCTATCATAAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025004.2-938s21c1
Sequence:CCGGAGAGGAGAGTTGCCCATTAAGCTCGAGCTTAATGGGCAACTCTCCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081429
CCDC15 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 15
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081429.1-2735s21c1
Sequence:CCGGTCGAAATGCCATTCGTAATTTCTCGAGAAATTACGAATGGCATTTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081429.1-1202s21c1
Sequence:CCGGTCCAGAAGCCCAGGATTATTTCTCGAGAAATAATCCTGGGCTTCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081429.1-3018s21c1
Sequence:CCGGTTGGGCCTTAGAGCTAATATTCTCGAGAATATTAGCTCTAAGGCCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081429.1-2404s21c1
Sequence:CCGGACTGTCATGAAGAACCTTATTCTCGAGAATAAGGTTCTTCATGACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081429.1-468s21c1
Sequence:CCGGGAGAGGAACCAGGCCATAATACTCGAGTATTATGGCCTGGTTCCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081429
CCDC15 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 15
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081429.1-2735s21c1
Sequence:CCGGTCGAAATGCCATTCGTAATTTCTCGAGAAATTACGAATGGCATTTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081429.1-1202s21c1
Sequence:CCGGTCCAGAAGCCCAGGATTATTTCTCGAGAAATAATCCTGGGCTTCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081429.1-3018s21c1
Sequence:CCGGTTGGGCCTTAGAGCTAATATTCTCGAGAATATTAGCTCTAAGGCCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081429.1-2404s21c1
Sequence:CCGGACTGTCATGAAGAACCTTATTCTCGAGAATAAGGTTCTTCATGACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081429.1-468s21c1
Sequence:CCGGGAGAGGAACCAGGCCATAATACTCGAGTATTATGGCCTGGTTCCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081429
CCDC15 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 15
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081429.1-2735s21c1
Sequence:CCGGTCGAAATGCCATTCGTAATTTCTCGAGAAATTACGAATGGCATTTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081429.1-1202s21c1
Sequence:CCGGTCCAGAAGCCCAGGATTATTTCTCGAGAAATAATCCTGGGCTTCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081429.1-3018s21c1
Sequence:CCGGTTGGGCCTTAGAGCTAATATTCTCGAGAATATTAGCTCTAAGGCCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081429.1-2404s21c1
Sequence:CCGGACTGTCATGAAGAACCTTATTCTCGAGAATAAGGTTCTTCATGACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081429.1-468s21c1
Sequence:CCGGGAGAGGAACCAGGCCATAATACTCGAGTATTATGGCCTGGTTCCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)