EMAIL THIS PAGE TO A FRIEND

CCDC50

coiled-coil domain containing 50

102 Gene Product Result for
Synonyms: C3orf6 DFNA44 YMER
UniProtKB ID: Q8IVM0, Q86VH7
Gene ID:
Human(152137) Summary: This gene encodes a soluble, cytoplasmic, tyrosine-phosphorylated protein with multiple ubiquitin-interacting domains. Mutations in this gene cause nonsyndromic, postlingual, progressive sensorineural DFNA44 hearing loss. In mouse, the protein is expressed in the inner ear during development and postnatal maturation and associates with microtubule-based structures. This protein may also function as a negative regulator of NF-kB signaling and as an effector of epidermal growth factor (EGF)-mediated cell signaling. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Oct 2008]
Mouse(67501) coiled-coil domain containing 50
Rat(288022) coiled-coil domain containing 50
chicken(424906) coiled-coil domain containing 50
domestic cat(101080475) coiled-coil domain containing 50
cow(529404) coiled-coil domain containing 50
dog(478675) coiled-coil domain containing 50
sheep(101104368) coiled-coil domain containing 50
naked mole-rat(101704004) coiled-coil domain containing 50
domestic guinea pig(100715264) coiled-coil domain containing 50
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA001336 Anti-CCDC50 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
AV53355 Anti-CCDC50 antibody produced in rabbit affinity isolated antibody rabbit, human, bovine, mouse, guinea pig, horse, canine, rat
western blot pricing
SAB2105904 Anti-CCDC50 antibody produced in rabbit affinity isolated antibody rabbit, human, horse
western blot pricing
SAB2501120 Anti-YMER/CCDC50 affinity isolated antibody, buffered aqueous solution human, rat, chimpanzee
ELISA, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174908 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174908 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174908 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026202 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026202 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026202 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174908 Rosetta Predictions human pricing
NM_178335 Rosetta Predictions human pricing
NM_182736 Rosetta Predictions rat pricing
NM_001025615 Rosetta Predictions mouse pricing
NM_026202 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174908 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011368 predicted 1596
2 SASI_Hs01_00011369 predicted 1614
3 SASI_Hs01_00011370 predicted 1347
4 SASI_Hs01_00011371 predicted 727
5 SASI_Hs01_00011372 predicted 1560
6 SASI_Hs01_00011373 predicted 1345
7 SASI_Hs01_00011374 predicted 1438
8 SASI_Hs01_00011376 predicted 1250
9 SASI_Hs01_00011377 predicted 1535
10 SASI_Hs02_00368816 predicted 1510
11 SASI_Hs01_00011375 predicted 813
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178335 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035135 predicted 2129
2 SASI_Hs01_00035136 predicted 2137
3 SASI_Hs01_00035137 predicted 1873
4 SASI_Hs01_00035138 predicted 731
5 SASI_Hs01_00035139 predicted 2082
6 SASI_Hs01_00035140 predicted 1869
7 SASI_Hs01_00035141 predicted 1967
8 SASI_Hs01_00035143 predicted 1776
9 SASI_Hs01_00035144 predicted 2061
10 SASI_Hs02_00369639 predicted 2040
11 SASI_Hs01_00035142 predicted 815
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182736 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039882 predicted 207
2 SASI_Rn01_00039883 predicted 383
3 SASI_Rn01_00039884 predicted 402
4 SASI_Rn01_00039885 predicted 218
5 SASI_Rn01_00039886 predicted 230
6 SASI_Rn02_00269834 predicted 413
7 SASI_Rn01_00039887 predicted 375
8 SASI_Rn01_00039888 predicted 284
9 SASI_Rn02_00269835 predicted 300
10 SASI_Rn01_00039889 predicted 220
11 SASI_Rn01_00039890 predicted 405
12 SASI_Rn01_00039891 predicted 321
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025615 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102254 predicted 211
2 SASI_Mm01_00102255 predicted 1038
3 SASI_Mm01_00102256 predicted 399
4 SASI_Mm01_00102257 predicted 1029
5 SASI_Mm01_00102258 predicted 338
6 SASI_Mm01_00102259 predicted 339
7 SASI_Mm01_00102260 predicted 225
8 SASI_Mm02_00288000 predicted 1180
9 SASI_Mm01_00102262 predicted 220
10 SASI_Mm01_00102263 predicted 390
11 SASI_Mm01_00102261 predicted 947
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026202 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136522 predicted 205
2 SASI_Mm01_00136523 predicted 1084
3 SASI_Mm01_00136524 predicted 392
4 SASI_Mm01_00136525 predicted 1076
5 SASI_Mm01_00136526 predicted 339
6 SASI_Mm01_00136527 predicted 345
7 SASI_Mm01_00136528 predicted 226
8 SASI_Mm02_00329870 predicted 1229
9 SASI_Mm01_00136530 predicted 221
10 SASI_Mm01_00136531 predicted 390
11 SASI_Mm01_00136529 predicted 997
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174908
VALIDATED
CCDC50 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 50
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430382    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174908.3-1684s21c1
Sequence:CCGGATGATCACTTGGGCAGTATAACTCGAGTTATACTGCCCAAGTGATCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149472    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174908.2-1739s1c1
Sequence:CCGGGCTGCATATACTTCTTGGGATCTCGAGATCCCAAGAAGTATATGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_174908.2-816s1c1
Sequence:CCGGCGCTACAAAGACCTTGAACAACTCGAGTTGTTCAAGGTCTTTGTAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174908.2-1209s1c1
Sequence:CCGGCGACTTCTAATGGCTGAAGAACTCGAGTTCTTCAGCCATTAGAAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147619    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_174908.2-1771s1c1
Sequence:CCGGGACCTTTGTAAACTGCCATTTCTCGAGAAATGGCAGTTTACAAAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131115    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_174908.2-1728s1c1
Sequence:CCGGGCCACCTCTATGCTGCATATACTCGAGTATATGCAGCATAGAGGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_174908.2-1256s1c1
Sequence:CCGGGCGGGAGAAATCATCTTTGGACTCGAGTCCAAAGATGATTTCTCCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_174908.2-693s1c1
Sequence:CCGGGAACAAGAGATTGAGCATCATCTCGAGATGATGCTCAATCTCTTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174908.2-828s1c1
Sequence:CCGGCTTGAACAACAAGACTGTGAACTCGAGTTCACAGTCTTGTTGTTCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174908
VALIDATED
CCDC50 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 50
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430382    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174908.3-1684s21c1
Sequence:CCGGATGATCACTTGGGCAGTATAACTCGAGTTATACTGCCCAAGTGATCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149472    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174908.2-1739s1c1
Sequence:CCGGGCTGCATATACTTCTTGGGATCTCGAGATCCCAAGAAGTATATGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_174908.2-816s1c1
Sequence:CCGGCGCTACAAAGACCTTGAACAACTCGAGTTGTTCAAGGTCTTTGTAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174908.2-1209s1c1
Sequence:CCGGCGACTTCTAATGGCTGAAGAACTCGAGTTCTTCAGCCATTAGAAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147619    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_174908.2-1771s1c1
Sequence:CCGGGACCTTTGTAAACTGCCATTTCTCGAGAAATGGCAGTTTACAAAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131115    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_174908.2-1728s1c1
Sequence:CCGGGCCACCTCTATGCTGCATATACTCGAGTATATGCAGCATAGAGGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_174908.2-1256s1c1
Sequence:CCGGGCGGGAGAAATCATCTTTGGACTCGAGTCCAAAGATGATTTCTCCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_174908.2-693s1c1
Sequence:CCGGGAACAAGAGATTGAGCATCATCTCGAGATGATGCTCAATCTCTTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174908.2-828s1c1
Sequence:CCGGCTTGAACAACAAGACTGTGAACTCGAGTTCACAGTCTTGTTGTTCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174908
VALIDATED
CCDC50 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 50
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430382    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174908.3-1684s21c1
Sequence:CCGGATGATCACTTGGGCAGTATAACTCGAGTTATACTGCCCAAGTGATCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149472    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174908.2-1739s1c1
Sequence:CCGGGCTGCATATACTTCTTGGGATCTCGAGATCCCAAGAAGTATATGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_174908.2-816s1c1
Sequence:CCGGCGCTACAAAGACCTTGAACAACTCGAGTTGTTCAAGGTCTTTGTAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146450    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174908.2-1209s1c1
Sequence:CCGGCGACTTCTAATGGCTGAAGAACTCGAGTTCTTCAGCCATTAGAAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147619    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_174908.2-1771s1c1
Sequence:CCGGGACCTTTGTAAACTGCCATTTCTCGAGAAATGGCAGTTTACAAAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131115    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_174908.2-1728s1c1
Sequence:CCGGGCCACCTCTATGCTGCATATACTCGAGTATATGCAGCATAGAGGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_174908.2-1256s1c1
Sequence:CCGGGCGGGAGAAATCATCTTTGGACTCGAGTCCAAAGATGATTTCTCCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_174908.2-693s1c1
Sequence:CCGGGAACAAGAGATTGAGCATCATCTCGAGATGATGCTCAATCTCTTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174908.2-828s1c1
Sequence:CCGGCTTGAACAACAAGACTGTGAACTCGAGTTCACAGTCTTGTTGTTCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026202
VALIDATED
CCDC50 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 50
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000328929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026202.3-327s21c1
Sequence:CCGGAGCTCCAGAAGCGCTACAAAGCTCGAGCTTTGTAGCGCTTCTGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328993    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026202.3-1454s21c1
Sequence:CCGGGCAGCTGCTTTGCTGTTTATTCTCGAGAATAAACAGCAAAGCAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026202.3-809s21c1
Sequence:CCGGCATGACCCTGAATGCAAGTTACTCGAGTAACTTGCATTCAGGGTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026202.3-217s21c1
Sequence:CCGGACAAGAGATTGAGCATCATTTCTCGAGAAATGATGCTCAATCTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026202.3-721s21c1
Sequence:CCGGGGAAATTGCTCGACTTCTAATCTCGAGATTAGAAGTCGAGCAATTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026202.1-797s1c1
Sequence:CCGGCCAAGATTGACAGGCCATCAACTCGAGTTGATGGCCTGTCAATCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026202.1-878s1c1
Sequence:CCGGGCACAGTACAACATGGCATCTCTCGAGAGATGCCATGTTGTACTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026202.1-1367s1c1
Sequence:CCGGGCAGCTGCTTTGCTGTTTATTCTCGAGAATAAACAGCAAAGCAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026202.1-724s1c1
Sequence:CCGGCATGACCCTGAATGCAAGTTACTCGAGTAACTTGCATTCAGGGTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026202
VALIDATED
CCDC50 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 50
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000328929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026202.3-327s21c1
Sequence:CCGGAGCTCCAGAAGCGCTACAAAGCTCGAGCTTTGTAGCGCTTCTGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328993    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026202.3-1454s21c1
Sequence:CCGGGCAGCTGCTTTGCTGTTTATTCTCGAGAATAAACAGCAAAGCAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026202.3-809s21c1
Sequence:CCGGCATGACCCTGAATGCAAGTTACTCGAGTAACTTGCATTCAGGGTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026202.3-217s21c1
Sequence:CCGGACAAGAGATTGAGCATCATTTCTCGAGAAATGATGCTCAATCTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026202.3-721s21c1
Sequence:CCGGGGAAATTGCTCGACTTCTAATCTCGAGATTAGAAGTCGAGCAATTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026202.1-797s1c1
Sequence:CCGGCCAAGATTGACAGGCCATCAACTCGAGTTGATGGCCTGTCAATCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026202.1-878s1c1
Sequence:CCGGGCACAGTACAACATGGCATCTCTCGAGAGATGCCATGTTGTACTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026202.1-1367s1c1
Sequence:CCGGGCAGCTGCTTTGCTGTTTATTCTCGAGAATAAACAGCAAAGCAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026202.1-724s1c1
Sequence:CCGGCATGACCCTGAATGCAAGTTACTCGAGTAACTTGCATTCAGGGTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026202
VALIDATED
CCDC50 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 50
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000328929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026202.3-327s21c1
Sequence:CCGGAGCTCCAGAAGCGCTACAAAGCTCGAGCTTTGTAGCGCTTCTGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328993    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026202.3-1454s21c1
Sequence:CCGGGCAGCTGCTTTGCTGTTTATTCTCGAGAATAAACAGCAAAGCAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026202.3-809s21c1
Sequence:CCGGCATGACCCTGAATGCAAGTTACTCGAGTAACTTGCATTCAGGGTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026202.3-217s21c1
Sequence:CCGGACAAGAGATTGAGCATCATTTCTCGAGAAATGATGCTCAATCTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026202.3-721s21c1
Sequence:CCGGGGAAATTGCTCGACTTCTAATCTCGAGATTAGAAGTCGAGCAATTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026202.1-797s1c1
Sequence:CCGGCCAAGATTGACAGGCCATCAACTCGAGTTGATGGCCTGTCAATCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026202.1-878s1c1
Sequence:CCGGGCACAGTACAACATGGCATCTCTCGAGAGATGCCATGTTGTACTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026202.1-1367s1c1
Sequence:CCGGGCAGCTGCTTTGCTGTTTATTCTCGAGAATAAACAGCAAAGCAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026202.1-724s1c1
Sequence:CCGGCATGACCCTGAATGCAAGTTACTCGAGTAACTTGCATTCAGGGTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)