EMAIL THIS PAGE TO A FRIEND

CCDC58

coiled-coil domain containing 58

67 Gene Product Result for
UniProtKB ID: Q4VC31, Q32LY6
Gene ID:
Mouse(381045) coiled-coil domain containing 58
Rat(288065) coiled-coil domain containing 58
sheep(101113031) coiled-coil domain containing 58
domestic guinea pig(100728109) coiled-coil domain containing 58
naked mole-rat(101725932) coiled-coil domain containing 58
Zebrafish(393780) coiled-coil domain containing 58
cow(508149) coiled-coil domain containing 58
domestic cat(101086339) coiled-coil domain containing 58
dog(478583) coiled-coil domain containing 58
chicken(418269) coiled-coil domain containing 58
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001017928 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001017928 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001017928 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198645 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198645 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198645 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU042821 MISSION® esiRNA esiRNA targeting mouse Ccdc58 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017928 Rosetta Predictions human pricing
NM_001105875 Rosetta Predictions rat pricing
NM_198645 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017928 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108408 predicted 220
2 SASI_Hs01_00108410 predicted 42
3 SASI_Hs01_00108411 predicted 143
4 SASI_Hs01_00108413 predicted 223
5 SASI_Hs01_00108414 predicted 51
6 SASI_Hs01_00108415 predicted 595
7 SASI_Hs01_00108417 predicted 544
8 SASI_Hs01_00108409 predicted 112
9 SASI_Hs02_00306813 predicted 500
10 SASI_Hs02_00306814 predicted 407
11 SASI_Hs01_00108412 predicted 26
12 SASI_Hs01_00108416 predicted 82
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105875 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213392 predicted 687
2 SASI_Rn02_00213393 predicted 915
3 SASI_Rn02_00213394 predicted 642
4 SASI_Rn02_00213395 predicted 555
5 SASI_Rn02_00213396 predicted 684
6 SASI_Rn02_00213397 predicted 581
7 SASI_Rn02_00213398 predicted 814
8 SASI_Rn02_00213399 predicted 617
9 SASI_Rn02_00213400 predicted 869
10 SASI_Rn02_00213401 predicted 705
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198645 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077111 predicted 668
2 SASI_Mm01_00077112 predicted 768
3 SASI_Mm01_00077114 predicted 439
4 SASI_Mm01_00077115 predicted 625
5 SASI_Mm01_00077116 predicted 716
6 SASI_Mm02_00351115 predicted 804
7 SASI_Mm02_00351116 predicted 483
8 SASI_Mm01_00077118 predicted 727
9 SASI_Mm01_00077119 predicted 548
10 SASI_Mm01_00077120 predicted 578
11 SASI_Mm01_00077113 predicted 696
12 SASI_Mm01_00077117 predicted 472
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001017928
CCDC58 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 58
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017928.2-485s21c1
Sequence:CCGGGGTCATCTCATAAGAGCTAAGCTCGAGCTTAGCTCTTATGAGATGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017928.2-474s21c1
Sequence:CCGGTTTAAGGACTGGGTCATCTCACTCGAGTGAGATGACCCAGTCCTTAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017928.2-98s21c1
Sequence:CCGGATGAATTAAACACTACGGTTCCTCGAGGAACCGTAGTGTTTAATTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017928.2-69s21c1
Sequence:CCGGGATGAGGACAATTGATGACAGCTCGAGCTGTCATCAATTGTCCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129683    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001017928.1-479s1c1
Sequence:CCGGCATCTCATAAGAGCTAAGCATCTCGAGATGCTTAGCTCTTATGAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017928.1-516s1c1
Sequence:CCGGGCGGGCTTTCTAGGATGATTTCTCGAGAAATCATCCTAGAAAGCCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128644    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017928.1-327s1c1
Sequence:CCGGCAAAGTTGAAATGGATGCAGTCTCGAGACTGCATCCATTTCAACTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017928.1-201s1c1
Sequence:CCGGCCAGTAGAGACAGAGTCATAACTCGAGTTATGACTCTGTCTCTACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017928.1-55s1c1
Sequence:CCGGCCAGGAATTACTCAAGGTGATCTCGAGATCACCTTGAGTAATTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017928.1-343s1c1
Sequence:CCGGGCAGTCAGAACTGAATGTTGACTCGAGTCAACATTCAGTTCTGACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017928.1-322s1c1
Sequence:CCGGGCAGACAAAGTTGAAATGGATCTCGAGATCCATTTCAACTTTGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017928.1-179s1c1
Sequence:CCGGGAGTCTTTGATGGCAGCTCATCTCGAGATGAGCTGCCATCAAAGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001017928
CCDC58 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 58
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017928.2-485s21c1
Sequence:CCGGGGTCATCTCATAAGAGCTAAGCTCGAGCTTAGCTCTTATGAGATGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017928.2-474s21c1
Sequence:CCGGTTTAAGGACTGGGTCATCTCACTCGAGTGAGATGACCCAGTCCTTAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017928.2-98s21c1
Sequence:CCGGATGAATTAAACACTACGGTTCCTCGAGGAACCGTAGTGTTTAATTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017928.2-69s21c1
Sequence:CCGGGATGAGGACAATTGATGACAGCTCGAGCTGTCATCAATTGTCCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129683    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001017928.1-479s1c1
Sequence:CCGGCATCTCATAAGAGCTAAGCATCTCGAGATGCTTAGCTCTTATGAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017928.1-516s1c1
Sequence:CCGGGCGGGCTTTCTAGGATGATTTCTCGAGAAATCATCCTAGAAAGCCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128644    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017928.1-327s1c1
Sequence:CCGGCAAAGTTGAAATGGATGCAGTCTCGAGACTGCATCCATTTCAACTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017928.1-201s1c1
Sequence:CCGGCCAGTAGAGACAGAGTCATAACTCGAGTTATGACTCTGTCTCTACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017928.1-55s1c1
Sequence:CCGGCCAGGAATTACTCAAGGTGATCTCGAGATCACCTTGAGTAATTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017928.1-343s1c1
Sequence:CCGGGCAGTCAGAACTGAATGTTGACTCGAGTCAACATTCAGTTCTGACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017928.1-322s1c1
Sequence:CCGGGCAGACAAAGTTGAAATGGATCTCGAGATCCATTTCAACTTTGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017928.1-179s1c1
Sequence:CCGGGAGTCTTTGATGGCAGCTCATCTCGAGATGAGCTGCCATCAAAGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001017928
CCDC58 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 58
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017928.2-485s21c1
Sequence:CCGGGGTCATCTCATAAGAGCTAAGCTCGAGCTTAGCTCTTATGAGATGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017928.2-474s21c1
Sequence:CCGGTTTAAGGACTGGGTCATCTCACTCGAGTGAGATGACCCAGTCCTTAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017928.2-98s21c1
Sequence:CCGGATGAATTAAACACTACGGTTCCTCGAGGAACCGTAGTGTTTAATTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017928.2-69s21c1
Sequence:CCGGGATGAGGACAATTGATGACAGCTCGAGCTGTCATCAATTGTCCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129683    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001017928.1-479s1c1
Sequence:CCGGCATCTCATAAGAGCTAAGCATCTCGAGATGCTTAGCTCTTATGAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017928.1-516s1c1
Sequence:CCGGGCGGGCTTTCTAGGATGATTTCTCGAGAAATCATCCTAGAAAGCCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128644    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017928.1-327s1c1
Sequence:CCGGCAAAGTTGAAATGGATGCAGTCTCGAGACTGCATCCATTTCAACTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017928.1-201s1c1
Sequence:CCGGCCAGTAGAGACAGAGTCATAACTCGAGTTATGACTCTGTCTCTACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017928.1-55s1c1
Sequence:CCGGCCAGGAATTACTCAAGGTGATCTCGAGATCACCTTGAGTAATTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017928.1-343s1c1
Sequence:CCGGGCAGTCAGAACTGAATGTTGACTCGAGTCAACATTCAGTTCTGACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017928.1-322s1c1
Sequence:CCGGGCAGACAAAGTTGAAATGGATCTCGAGATCCATTTCAACTTTGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017928.1-179s1c1
Sequence:CCGGGAGTCTTTGATGGCAGCTCATCTCGAGATGAGCTGCCATCAAAGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198645
VALIDATED
CCDC58 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 58
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198645.1-630s21c1
Sequence:CCGGCCAGACCTCAGCAGTAGTAAACTCGAGTTTACTACTGCTGAGGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198645.1-597s21c1
Sequence:CCGGCAGTAGGGACAGAGTTATAAACTCGAGTTTATAACTCTGTCCCTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198645.1-752s21c1
Sequence:CCGGATGTCGAAGAAGTGGTAAATGCTCGAGCATTTACCACTTCTTCGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198645.1-679s21c1
Sequence:CCGGCTGGATGACTTAACGTTATTACTCGAGTAATAACGTTAAGTCATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257573    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198645.1-868s21c1
Sequence:CCGGCATCGCCTGGGCATGACAGATCTCGAGATCTGTCATGCCCAGGCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201071    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198645.1-553s1c1
Sequence:CCGGCAAACCTGTAAACAGCTGTATCTCGAGATACAGCTGTTTACAGGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198645.1-678s1c1
Sequence:CCGGCCTGGATGACTTAACGTTATTCTCGAGAATAACGTTAAGTCATCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189838    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198645.1-806s1c1
Sequence:CCGGGAGTTCACTTCAAGCCTCCAACTCGAGTTGGAGGCTTGAAGTGAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198645
VALIDATED
CCDC58 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 58
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198645.1-630s21c1
Sequence:CCGGCCAGACCTCAGCAGTAGTAAACTCGAGTTTACTACTGCTGAGGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198645.1-597s21c1
Sequence:CCGGCAGTAGGGACAGAGTTATAAACTCGAGTTTATAACTCTGTCCCTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198645.1-752s21c1
Sequence:CCGGATGTCGAAGAAGTGGTAAATGCTCGAGCATTTACCACTTCTTCGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198645.1-679s21c1
Sequence:CCGGCTGGATGACTTAACGTTATTACTCGAGTAATAACGTTAAGTCATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257573    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198645.1-868s21c1
Sequence:CCGGCATCGCCTGGGCATGACAGATCTCGAGATCTGTCATGCCCAGGCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201071    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198645.1-553s1c1
Sequence:CCGGCAAACCTGTAAACAGCTGTATCTCGAGATACAGCTGTTTACAGGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198645.1-678s1c1
Sequence:CCGGCCTGGATGACTTAACGTTATTCTCGAGAATAACGTTAAGTCATCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189838    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198645.1-806s1c1
Sequence:CCGGGAGTTCACTTCAAGCCTCCAACTCGAGTTGGAGGCTTGAAGTGAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198645
VALIDATED
CCDC58 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 58
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198645.1-630s21c1
Sequence:CCGGCCAGACCTCAGCAGTAGTAAACTCGAGTTTACTACTGCTGAGGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198645.1-597s21c1
Sequence:CCGGCAGTAGGGACAGAGTTATAAACTCGAGTTTATAACTCTGTCCCTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198645.1-752s21c1
Sequence:CCGGATGTCGAAGAAGTGGTAAATGCTCGAGCATTTACCACTTCTTCGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198645.1-679s21c1
Sequence:CCGGCTGGATGACTTAACGTTATTACTCGAGTAATAACGTTAAGTCATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257573    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198645.1-868s21c1
Sequence:CCGGCATCGCCTGGGCATGACAGATCTCGAGATCTGTCATGCCCAGGCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201071    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198645.1-553s1c1
Sequence:CCGGCAAACCTGTAAACAGCTGTATCTCGAGATACAGCTGTTTACAGGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198645.1-678s1c1
Sequence:CCGGCCTGGATGACTTAACGTTATTCTCGAGAATAACGTTAAGTCATCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189838    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198645.1-806s1c1
Sequence:CCGGGAGTTCACTTCAAGCCTCCAACTCGAGTTGGAGGCTTGAAGTGAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)