EMAIL THIS PAGE TO A FRIEND

CCDC61

coiled-coil domain containing 61

65 Gene Product Result for
UniProtKB ID: Q9Y6R9, Q9HDB6
Gene ID:
Mouse(232933) coiled-coil domain containing 61
Rat(292680) coiled-coil domain containing 61
sheep(101120433) coiled-coil domain containing 61
domestic guinea pig(100714918) coiled-coil domain containing 61
naked mole-rat(101699682) coiled-coil domain containing 61
Zebrafish(798766) coiled-coil domain containing 61
cow(515425) coiled-coil domain containing 61
domestic cat(101091828) coiled-coil domain containing 61
dog(476430) coiled-coil domain containing 61
chicken(424880) coiled-coil domain containing 61
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080402 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080402 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080402 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033314 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033314 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033314 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080402 Rosetta Predictions human pricing
NM_001106229 Rosetta Predictions rat pricing
XM_214875 Rosetta Predictions rat pricing
XR_009008 Rosetta Predictions rat pricing
NM_001033314 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080402 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314508 predicted 338
2 SASI_Hs02_00314509 predicted 382
3 SASI_Hs02_00314510 predicted 1322
4 SASI_Hs02_00314511 predicted 1568
5 SASI_Hs02_00314512 predicted 309
6 SASI_Hs02_00314513 predicted 299
7 SASI_Hs02_00314514 predicted 1539
8 SASI_Hs02_00314515 predicted 293
9 SASI_Hs02_00314516 predicted 541
10 SASI_Hs02_00314517 predicted 295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106229 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216908 predicted 571
2 SASI_Rn02_00216909 predicted 1712
3 SASI_Rn02_00216910 predicted 695
4 SASI_Rn02_00216911 predicted 1801
5 SASI_Rn02_00216912 predicted 878
6 SASI_Rn02_00216913 predicted 452
7 SASI_Rn02_00216914 predicted 573
8 SASI_Rn02_00216915 predicted 714
9 SASI_Rn02_00216916 predicted 483
10 SASI_Rn02_00216917 predicted 614
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214875 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00189444 predicted 408
2 SASI_Rn01_00189445 predicted 294
3 SASI_Rn01_00189446 predicted 378
4 SASI_Rn01_00189447 predicted 362
5 SASI_Rn01_00189448 predicted 300
6 SASI_Rn01_00189449 predicted 321
7 SASI_Rn01_00189450 predicted 356
8 SASI_Rn01_00189451 predicted 264
9 SASI_Rn01_00189452 predicted 249
10 SASI_Rn01_00189453 predicted 372
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009008 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00169692 predicted 453
2 SASI_Rn01_00169693 predicted 217
3 SASI_Rn01_00169694 predicted 235
4 SASI_Rn01_00169695 predicted 643
5 SASI_Rn01_00169696 predicted 468
6 SASI_Rn01_00169697 predicted 398
7 SASI_Rn01_00169698 predicted 244
8 SASI_Rn01_00169699 predicted 664
9 SASI_Rn01_00169700 predicted 712
10 SASI_Rn01_00169701 predicted 695
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033314 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121831 predicted 630
2 SASI_Mm01_00121832 predicted 1472
3 SASI_Mm01_00121833 predicted 1665
4 SASI_Mm01_00121834 predicted 456
5 SASI_Mm01_00121835 predicted 1550
6 SASI_Mm01_00121836 predicted 747
7 SASI_Mm01_00121837 predicted 823
8 SASI_Mm01_00121838 predicted 1379
9 SASI_Mm01_00121839 predicted 1120
10 SASI_Mm01_00121840 predicted 397
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080402
CCDC61 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 61
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080402.1-360s21c1
Sequence:CCGGGTTCAACATCTTCTGTCATATCTCGAGATATGACAGAAGATGTTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080402.1-1630s21c1
Sequence:CCGGCCCACTTGCTGGGTATGGTGTCTCGAGACACCATACCCAGCAAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080402.1-312s21c1
Sequence:CCGGTGCTGGCTTCATTGAAGATTTCTCGAGAAATCTTCAATGAAGCCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080402.1-1576s21c1
Sequence:CCGGCGACTGGACATGCGGTCATAACTCGAGTTATGACCGCATGTCCAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080402.1-536s21c1
Sequence:CCGGTCATCTACTCCGTGGAGTTTGCTCGAGCAAACTCCACGGAGTAGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080402
CCDC61 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 61
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080402.1-360s21c1
Sequence:CCGGGTTCAACATCTTCTGTCATATCTCGAGATATGACAGAAGATGTTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080402.1-1630s21c1
Sequence:CCGGCCCACTTGCTGGGTATGGTGTCTCGAGACACCATACCCAGCAAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080402.1-312s21c1
Sequence:CCGGTGCTGGCTTCATTGAAGATTTCTCGAGAAATCTTCAATGAAGCCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080402.1-1576s21c1
Sequence:CCGGCGACTGGACATGCGGTCATAACTCGAGTTATGACCGCATGTCCAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080402.1-536s21c1
Sequence:CCGGTCATCTACTCCGTGGAGTTTGCTCGAGCAAACTCCACGGAGTAGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080402
CCDC61 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 61
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080402.1-360s21c1
Sequence:CCGGGTTCAACATCTTCTGTCATATCTCGAGATATGACAGAAGATGTTGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080402.1-1630s21c1
Sequence:CCGGCCCACTTGCTGGGTATGGTGTCTCGAGACACCATACCCAGCAAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080402.1-312s21c1
Sequence:CCGGTGCTGGCTTCATTGAAGATTTCTCGAGAAATCTTCAATGAAGCCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080402.1-1576s21c1
Sequence:CCGGCGACTGGACATGCGGTCATAACTCGAGTTATGACCGCATGTCCAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080402.1-536s21c1
Sequence:CCGGTCATCTACTCCGTGGAGTTTGCTCGAGCAAACTCCACGGAGTAGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033314
VALIDATED
CCDC61 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 61
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033314.1-1559s1c1
Sequence:CCGGGAGGATTTCTCCCACTCAGTTCTCGAGAACTGAGTGGGAGAAATCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033314.1-630s1c1
Sequence:CCGGCCAAACGCTACCTCATTCTCACTCGAGTGAGAATGAGGTAGCGTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033314.1-433s1c1
Sequence:CCGGCATTGAAGACTTGACTCATAACTCGAGTTATGAGTCAAGTCTTCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033314.1-460s1c1
Sequence:CCGGGAACTTTAAACAGTTCAGCATCTCGAGATGCTGAACTGTTTAAAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200827    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033314.1-1830s1c1
Sequence:CCGGGTGGTATTCTGATTTCTCATTCTCGAGAATGAGAAATCAGAATACCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033314.1-1342s1c1
Sequence:CCGGGCAGAGAGAAATCAGGATGAACTCGAGTTCATCCTGATTTCTCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033314
VALIDATED
CCDC61 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 61
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033314.1-1559s1c1
Sequence:CCGGGAGGATTTCTCCCACTCAGTTCTCGAGAACTGAGTGGGAGAAATCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033314.1-630s1c1
Sequence:CCGGCCAAACGCTACCTCATTCTCACTCGAGTGAGAATGAGGTAGCGTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033314.1-433s1c1
Sequence:CCGGCATTGAAGACTTGACTCATAACTCGAGTTATGAGTCAAGTCTTCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033314.1-460s1c1
Sequence:CCGGGAACTTTAAACAGTTCAGCATCTCGAGATGCTGAACTGTTTAAAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200827    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033314.1-1830s1c1
Sequence:CCGGGTGGTATTCTGATTTCTCATTCTCGAGAATGAGAAATCAGAATACCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033314.1-1342s1c1
Sequence:CCGGGCAGAGAGAAATCAGGATGAACTCGAGTTCATCCTGATTTCTCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033314
VALIDATED
CCDC61 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 61
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033314.1-1559s1c1
Sequence:CCGGGAGGATTTCTCCCACTCAGTTCTCGAGAACTGAGTGGGAGAAATCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033314.1-630s1c1
Sequence:CCGGCCAAACGCTACCTCATTCTCACTCGAGTGAGAATGAGGTAGCGTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033314.1-433s1c1
Sequence:CCGGCATTGAAGACTTGACTCATAACTCGAGTTATGAGTCAAGTCTTCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033314.1-460s1c1
Sequence:CCGGGAACTTTAAACAGTTCAGCATCTCGAGATGCTGAACTGTTTAAAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200827    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033314.1-1830s1c1
Sequence:CCGGGTGGTATTCTGATTTCTCATTCTCGAGAATGAGAAATCAGAATACCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033314.1-1342s1c1
Sequence:CCGGGCAGAGAGAAATCAGGATGAACTCGAGTTCATCCTGATTTCTCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)