EMAIL THIS PAGE TO A FRIEND

CCDC87

coiled-coil domain containing 87

60 Gene Product Result for
UniProtKB ID: Q9NVE4, Q8NE76
Gene ID:
Mouse(399599) coiled-coil domain containing 87
Rat(689151) coiled-coil domain containing 87
sheep(101106215) coiled-coil domain containing 87
Domestic Rabbit(100337954) coiled-coil domain containing 87
naked mole-rat(101719040) coiled-coil domain containing 87
domestic guinea pig(100730908) coiled-coil domain containing 87
chicken(772157) coiled-coil domain containing 87
cow(618006) coiled-coil domain containing 87
cow(101904897) coiled-coil domain containing 87
Horse(100058610) coiled-coil domain containing 87
domestic cat(101087607) coiled-coil domain containing 87
dog(611893) coiled-coil domain containing 87
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207268 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207268 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207268 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018219 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018219 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018219 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU101861 MISSION® esiRNA esiRNA human CCDC87 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018219 Rosetta Predictions human pricing
NM_001109527 Rosetta Predictions rat pricing
NM_207268 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018219 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351530 predicted 1408
2 SASI_Hs01_00095068 predicted 1134
3 SASI_Hs01_00095069 predicted 2337
4 SASI_Hs01_00095070 predicted 2493
5 SASI_Hs01_00095071 predicted 667
6 SASI_Hs01_00095072 predicted 2574
7 SASI_Hs01_00095073 predicted 1672
8 SASI_Hs01_00095074 predicted 1718
9 SASI_Hs01_00095075 predicted 2387
10 SASI_Hs01_00095076 predicted 1571
11 SASI_Hs01_00095077 predicted 347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109527 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249279 predicted 330
2 SASI_Rn02_00249280 predicted 2367
3 SASI_Rn02_00249281 predicted 1333
4 SASI_Rn02_00249282 predicted 1495
5 SASI_Rn02_00249283 predicted 1545
6 SASI_Rn02_00249284 predicted 1869
7 SASI_Rn02_00249285 predicted 1514
8 SASI_Rn02_00249286 predicted 1775
9 SASI_Rn02_00249287 predicted 1818
10 SASI_Rn02_00249288 predicted 1054
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207268 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109982 predicted 1713
2 SASI_Mm01_00109983 predicted 2424
3 SASI_Mm01_00109985 predicted 1262
4 SASI_Mm02_00352014 predicted 2710
5 SASI_Mm01_00109986 predicted 1915
6 SASI_Mm01_00109987 predicted 532
7 SASI_Mm01_00109988 predicted 571
8 SASI_Mm01_00109989 predicted 2142
9 SASI_Mm02_00352015 predicted 2610
10 SASI_Mm01_00109990 predicted 2318
11 SASI_Mm01_00109984 predicted 2360
12 SASI_Mm01_00109991 predicted 1823
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207268
CCDC87 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 87
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207268.1-2009s1c1
Sequence:CCGGGCTAGAGTTCATGCAAGGAAACTCGAGTTTCCTTGCATGAACTCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207268.1-1901s1c1
Sequence:CCGGCCACGTCATCTTCCAAATGTACTCGAGTACATTTGGAAGATGACGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207268.1-2379s1c1
Sequence:CCGGCTCAATCGAATGGAATCTAATCTCGAGATTAGATTCCATTCGATTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207268.1-1365s1c1
Sequence:CCGGGCTTTGAAGGTACATGATCAACTCGAGTTGATCATGTACCTTCAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207268
CCDC87 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 87
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000201171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207268.1-2009s1c1
Sequence:CCGGGCTAGAGTTCATGCAAGGAAACTCGAGTTTCCTTGCATGAACTCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207268.1-1901s1c1
Sequence:CCGGCCACGTCATCTTCCAAATGTACTCGAGTACATTTGGAAGATGACGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207268.1-2379s1c1
Sequence:CCGGCTCAATCGAATGGAATCTAATCTCGAGATTAGATTCCATTCGATTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207268.1-1365s1c1
Sequence:CCGGGCTTTGAAGGTACATGATCAACTCGAGTTGATCATGTACCTTCAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207268
CCDC87 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 87
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000201171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207268.1-2009s1c1
Sequence:CCGGGCTAGAGTTCATGCAAGGAAACTCGAGTTTCCTTGCATGAACTCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207268.1-1901s1c1
Sequence:CCGGCCACGTCATCTTCCAAATGTACTCGAGTACATTTGGAAGATGACGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207268.1-2379s1c1
Sequence:CCGGCTCAATCGAATGGAATCTAATCTCGAGATTAGATTCCATTCGATTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207268.1-1365s1c1
Sequence:CCGGGCTTTGAAGGTACATGATCAACTCGAGTTGATCATGTACCTTCAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018219
CCDC87 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 87
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018219.1-2491s1c1
Sequence:CCGGGAGATGCTCTATTGGCTGCAACTCGAGTTGCAGCCAATAGAGCATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137999    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018219.1-2676s1c1
Sequence:CCGGGCAGCTCATCTAGACCTCTTTCTCGAGAAAGAGGTCTAGATGAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018219.1-1333s1c1
Sequence:CCGGGTGACCATTACTTTGAAGCTTCTCGAGAAGCTTCAAAGTAATGGTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018219.1-1111s1c1
Sequence:CCGGGAGGATCTGAAGCAGTTGATACTCGAGTATCAACTGCTTCAGATCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135630    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018219.1-2688s1c1
Sequence:CCGGGACCTCTTTACTGCTTTGGAACTCGAGTTCCAAAGCAGTAAAGAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018219.1-2364s1c1
Sequence:CCGGCCACAGGAAGCTCAACTTAATCTCGAGATTAAGTTGAGCTTCCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018219.1-876s1c1
Sequence:CCGGCGACATCAGTTCCTCACAGATCTCGAGATCTGTGAGGAACTGATGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018219.1-348s1c1
Sequence:CCGGCGAACTTAGTCTGAGCCACAACTCGAGTTGTGGCTCAGACTAAGTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018219.2-2161s21c1
Sequence:CCGGAGGTGGACATGACCATTAAATCTCGAGATTTAATGGTCATGTCCACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018219.2-1133s21c1
Sequence:CCGGGGATCTGAAGCAGTTGATAAACTCGAGTTTATCAACTGCTTCAGATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018219.2-1404s21c1
Sequence:CCGGGTACGGGTCTCTGATAGAAACCTCGAGGTTTCTATCAGAGACCCGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018219.2-1612s21c1
Sequence:CCGGTTGAGCCTGCAGCAGATAAAGCTCGAGCTTTATCTGCTGCAGGCTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018219
CCDC87 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 87
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018219.1-2491s1c1
Sequence:CCGGGAGATGCTCTATTGGCTGCAACTCGAGTTGCAGCCAATAGAGCATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137999    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018219.1-2676s1c1
Sequence:CCGGGCAGCTCATCTAGACCTCTTTCTCGAGAAAGAGGTCTAGATGAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018219.1-1333s1c1
Sequence:CCGGGTGACCATTACTTTGAAGCTTCTCGAGAAGCTTCAAAGTAATGGTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018219.1-1111s1c1
Sequence:CCGGGAGGATCTGAAGCAGTTGATACTCGAGTATCAACTGCTTCAGATCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135630    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018219.1-2688s1c1
Sequence:CCGGGACCTCTTTACTGCTTTGGAACTCGAGTTCCAAAGCAGTAAAGAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018219.1-2364s1c1
Sequence:CCGGCCACAGGAAGCTCAACTTAATCTCGAGATTAAGTTGAGCTTCCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018219.1-876s1c1
Sequence:CCGGCGACATCAGTTCCTCACAGATCTCGAGATCTGTGAGGAACTGATGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018219.1-348s1c1
Sequence:CCGGCGAACTTAGTCTGAGCCACAACTCGAGTTGTGGCTCAGACTAAGTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018219.2-2161s21c1
Sequence:CCGGAGGTGGACATGACCATTAAATCTCGAGATTTAATGGTCATGTCCACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018219.2-1133s21c1
Sequence:CCGGGGATCTGAAGCAGTTGATAAACTCGAGTTTATCAACTGCTTCAGATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018219.2-1404s21c1
Sequence:CCGGGTACGGGTCTCTGATAGAAACCTCGAGGTTTCTATCAGAGACCCGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018219.2-1612s21c1
Sequence:CCGGTTGAGCCTGCAGCAGATAAAGCTCGAGCTTTATCTGCTGCAGGCTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018219
CCDC87 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 87
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018219.1-2491s1c1
Sequence:CCGGGAGATGCTCTATTGGCTGCAACTCGAGTTGCAGCCAATAGAGCATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137999    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018219.1-2676s1c1
Sequence:CCGGGCAGCTCATCTAGACCTCTTTCTCGAGAAAGAGGTCTAGATGAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018219.1-1333s1c1
Sequence:CCGGGTGACCATTACTTTGAAGCTTCTCGAGAAGCTTCAAAGTAATGGTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018219.1-1111s1c1
Sequence:CCGGGAGGATCTGAAGCAGTTGATACTCGAGTATCAACTGCTTCAGATCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135630    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018219.1-2688s1c1
Sequence:CCGGGACCTCTTTACTGCTTTGGAACTCGAGTTCCAAAGCAGTAAAGAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018219.1-2364s1c1
Sequence:CCGGCCACAGGAAGCTCAACTTAATCTCGAGATTAAGTTGAGCTTCCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018219.1-876s1c1
Sequence:CCGGCGACATCAGTTCCTCACAGATCTCGAGATCTGTGAGGAACTGATGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018219.1-348s1c1
Sequence:CCGGCGAACTTAGTCTGAGCCACAACTCGAGTTGTGGCTCAGACTAAGTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018219.2-2161s21c1
Sequence:CCGGAGGTGGACATGACCATTAAATCTCGAGATTTAATGGTCATGTCCACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018219.2-1133s21c1
Sequence:CCGGGGATCTGAAGCAGTTGATAAACTCGAGTTTATCAACTGCTTCAGATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018219.2-1404s21c1
Sequence:CCGGGTACGGGTCTCTGATAGAAACCTCGAGGTTTCTATCAGAGACCCGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018219.2-1612s21c1
Sequence:CCGGTTGAGCCTGCAGCAGATAAAGCTCGAGCTTTATCTGCTGCAGGCTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)