EMAIL THIS PAGE TO A FRIEND

CCDC97

coiled-coil domain containing 97

84 Gene Product Result for
UniProtKB ID: Q96F63, Q658N6, Q96IF3
Gene ID:
Mouse(52132) coiled-coil domain containing 97
Rat(292724) coiled-coil domain containing 97
cow(505592) coiled-coil domain containing 97
dog(484489) coiled-coil domain containing 97
domestic cat(101088447) coiled-coil domain containing 97
sheep(101102506) coiled-coil domain containing 97
naked mole-rat(101703154) coiled-coil domain containing 97
domestic guinea pig(100730510) coiled-coil domain containing 97
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028771 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028771 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028771 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052848 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052848 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052848 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052848 Rosetta Predictions human pricing
NM_001106235 Rosetta Predictions rat pricing
NM_028771 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052848 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222496 predicted 310
2 SASI_Hs01_00222497 predicted 379
3 SASI_Hs01_00222498 predicted 360
4 SASI_Hs01_00222499 predicted 366
5 SASI_Hs01_00222500 predicted 1273
6 SASI_Hs01_00222501 predicted 1279
7 SASI_Hs01_00222502 predicted 1267
8 SASI_Hs02_00361530 predicted 1270
9 SASI_Hs01_00222504 predicted 1014
10 SASI_Hs01_00222505 predicted 208
11 SASI_Hs01_00222503 predicted 1216
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106235 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216968 predicted 1096
2 SASI_Rn02_00216969 predicted 532
3 SASI_Rn02_00216970 predicted 1576
4 SASI_Rn02_00216971 predicted 701
5 SASI_Rn02_00216972 predicted 622
6 SASI_Rn02_00216973 predicted 1653
7 SASI_Rn02_00216974 predicted 648
8 SASI_Rn02_00216975 predicted 655
9 SASI_Rn02_00216976 predicted 720
10 SASI_Rn02_00216977 predicted 330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028771 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177834 predicted 905
2 SASI_Mm01_00177835 predicted 1400
3 SASI_Mm01_00177836 predicted 581
4 SASI_Mm01_00177837 predicted 589
5 SASI_Mm01_00177838 predicted 1196
6 SASI_Mm01_00177839 predicted 555
7 SASI_Mm01_00177840 predicted 399
8 SASI_Mm01_00177841 predicted 1530
9 SASI_Mm01_00177842 predicted 462
10 SASI_Mm01_00177843 predicted 946
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028771
CCDC97 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 97
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028771.2-115s1c1
Sequence:CCGGACGGAGAGGAAGCCGGATAATCTCGAGATTATCCGGCTTCCTCTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219460    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028771.2-2468s1c1
Sequence:CCGGCTGCCCTCTGTATCAAGTAAACTCGAGTTTACTTGATACAGAGGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028771.2-856s1c1
Sequence:CCGGGAAGACCAGAGGTCGGATAAACTCGAGTTTATCCGACCTCTGGTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219461    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028771.2-1040s1c1
Sequence:CCGGATGAGGAGGACCGGTACTTTGCTCGAGCAAAGTACCGGTCCTCCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219459    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028771.2-584s1c1
Sequence:CCGGTCCAAGGAGGCGAGTACTTTACTCGAGTAAAGTACTCGCCTCCTTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028771
CCDC97 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 97
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028771.2-115s1c1
Sequence:CCGGACGGAGAGGAAGCCGGATAATCTCGAGATTATCCGGCTTCCTCTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219460    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028771.2-2468s1c1
Sequence:CCGGCTGCCCTCTGTATCAAGTAAACTCGAGTTTACTTGATACAGAGGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028771.2-856s1c1
Sequence:CCGGGAAGACCAGAGGTCGGATAAACTCGAGTTTATCCGACCTCTGGTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219461    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028771.2-1040s1c1
Sequence:CCGGATGAGGAGGACCGGTACTTTGCTCGAGCAAAGTACCGGTCCTCCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219459    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028771.2-584s1c1
Sequence:CCGGTCCAAGGAGGCGAGTACTTTACTCGAGTAAAGTACTCGCCTCCTTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028771
CCDC97 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 97
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028771.2-115s1c1
Sequence:CCGGACGGAGAGGAAGCCGGATAATCTCGAGATTATCCGGCTTCCTCTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219460    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028771.2-2468s1c1
Sequence:CCGGCTGCCCTCTGTATCAAGTAAACTCGAGTTTACTTGATACAGAGGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028771.2-856s1c1
Sequence:CCGGGAAGACCAGAGGTCGGATAAACTCGAGTTTATCCGACCTCTGGTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219461    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028771.2-1040s1c1
Sequence:CCGGATGAGGAGGACCGGTACTTTGCTCGAGCAAAGTACCGGTCCTCCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219459    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028771.2-584s1c1
Sequence:CCGGTCCAAGGAGGCGAGTACTTTACTCGAGTAAAGTACTCGCCTCCTTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052848
VALIDATED
CCDC97 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 97
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052848.1-1104s1c1
Sequence:CCGGGATGAGGAAGAACCTGAGGATCTCGAGATCCTCAGGTTCTTCCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052848.1-632s1c1
Sequence:CCGGGTACTTCAGTGATGAGCAGATCTCGAGATCTGCTCATCACTGAAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164386    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052848.1-1695s1c1
Sequence:CCGGCCTCCTTGCTTCTGTTAGGTTCTCGAGAACCTAACAGAAGCAAGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_052848.1-1083s1c1
Sequence:CCGGGATGAGGAGGAGAGGTACTTTCTCGAGAAAGTACCTCTCCTCCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052848.1-1020s1c1
Sequence:CCGGGACTTTGACTACAGCACAGTACTCGAGTACTGTGCTGTAGTCAAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_052848.1-1086s1c1
Sequence:CCGGGAGGAGGAGAGGTACTTTGATCTCGAGATCAAAGTACCTCTCCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052848.1-667s1c1
Sequence:CCGGCCCTGCTATATGAGCAGTACACTCGAGTGTACTGCTCATATAGCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052848.1-1092s1c1
Sequence:CCGGGAGAGGTACTTTGATGAGGAACTCGAGTTCCTCATCAAAGTACCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052848
VALIDATED
CCDC97 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 97
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052848.1-1104s1c1
Sequence:CCGGGATGAGGAAGAACCTGAGGATCTCGAGATCCTCAGGTTCTTCCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052848.1-632s1c1
Sequence:CCGGGTACTTCAGTGATGAGCAGATCTCGAGATCTGCTCATCACTGAAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164386    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052848.1-1695s1c1
Sequence:CCGGCCTCCTTGCTTCTGTTAGGTTCTCGAGAACCTAACAGAAGCAAGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_052848.1-1083s1c1
Sequence:CCGGGATGAGGAGGAGAGGTACTTTCTCGAGAAAGTACCTCTCCTCCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052848.1-1020s1c1
Sequence:CCGGGACTTTGACTACAGCACAGTACTCGAGTACTGTGCTGTAGTCAAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_052848.1-1086s1c1
Sequence:CCGGGAGGAGGAGAGGTACTTTGATCTCGAGATCAAAGTACCTCTCCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052848.1-667s1c1
Sequence:CCGGCCCTGCTATATGAGCAGTACACTCGAGTGTACTGCTCATATAGCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052848.1-1092s1c1
Sequence:CCGGGAGAGGTACTTTGATGAGGAACTCGAGTTCCTCATCAAAGTACCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052848
VALIDATED
CCDC97 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 97
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052848.1-1104s1c1
Sequence:CCGGGATGAGGAAGAACCTGAGGATCTCGAGATCCTCAGGTTCTTCCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052848.1-632s1c1
Sequence:CCGGGTACTTCAGTGATGAGCAGATCTCGAGATCTGCTCATCACTGAAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164386    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052848.1-1695s1c1
Sequence:CCGGCCTCCTTGCTTCTGTTAGGTTCTCGAGAACCTAACAGAAGCAAGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_052848.1-1083s1c1
Sequence:CCGGGATGAGGAGGAGAGGTACTTTCTCGAGAAAGTACCTCTCCTCCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052848.1-1020s1c1
Sequence:CCGGGACTTTGACTACAGCACAGTACTCGAGTACTGTGCTGTAGTCAAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_052848.1-1086s1c1
Sequence:CCGGGAGGAGGAGAGGTACTTTGATCTCGAGATCAAAGTACCTCTCCTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052848.1-667s1c1
Sequence:CCGGCCCTGCTATATGAGCAGTACACTCGAGTGTACTGCTCATATAGCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052848.1-1092s1c1
Sequence:CCGGGAGAGGTACTTTGATGAGGAACTCGAGTTCCTCATCAAAGTACCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)