EMAIL THIS PAGE TO A FRIEND

CCNI

cyclin I

64 Gene Product Result for
Synonyms: CYC1 CYI
UniProtKB ID: Q14094, B2R6M0
Gene ID:
Human(10983) Summary: The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin shows the highest similarity with cyclin G. The transcript of this gene was found to be expressed constantly during cell cycle progression. The function of this cyclin has not yet been determined. [provided by RefSeq, Jul 2008]
Mouse(12453) cyclin I
Rat(289500) cyclin I
cow(504847) cyclin I
Horse(100051356) cyclin I
dog(478440) cyclin I
chicken(422634) cyclin I
sheep(101110333) cyclin I
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017367 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_017367 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_017367 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006835 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006835 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006835 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006835 Rosetta Predictions human pricing
NM_001105998 Rosetta Predictions rat pricing
NM_017367 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006835 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052220 predicted 1174
2 SASI_Hs01_00052221 predicted 1549
3 SASI_Hs01_00052222 predicted 806
4 SASI_Hs02_00342401 predicted 1402
5 SASI_Hs01_00052223 predicted 1097
6 SASI_Hs01_00052224 predicted 1095
7 SASI_Hs01_00052225 predicted 929
8 SASI_Hs01_00052226 predicted 944
9 SASI_Hs01_00052227 predicted 1200
10 SASI_Hs02_00342402 predicted 1367
11 SASI_Hs01_00052218 predicted 1552
12 SASI_Hs01_00052219 predicted 874
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105998 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214622 predicted 865
2 SASI_Rn02_00214623 predicted 1243
3 SASI_Rn02_00214624 predicted 1039
4 SASI_Rn02_00214625 predicted 648
5 SASI_Rn02_00214626 predicted 880
6 SASI_Rn02_00214627 predicted 1055
7 SASI_Rn02_00214628 predicted 1139
8 SASI_Rn02_00214629 predicted 1206
9 SASI_Rn02_00214630 predicted 1035
10 SASI_Rn02_00214631 predicted 748
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017367 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122256 predicted 545
2 SASI_Mm01_00122257 predicted 918
3 SASI_Mm01_00122258 predicted 306
4 SASI_Mm01_00122259 predicted 560
5 SASI_Mm01_00122260 predicted 966
6 SASI_Mm01_00122261 predicted 819
7 SASI_Mm01_00122263 predicted 714
8 SASI_Mm01_00122264 predicted 419
9 SASI_Mm01_00122265 predicted 886
10 SASI_Mm02_00323845 predicted 734
11 SASI_Mm01_00122262 predicted 1203
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017367
VALIDATED
CCNI MISSION shRNA Bacterial Glycerol Stock
cyclin I
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017367.2-1662s1c1
Sequence:CCGGCCTCGGTTGAATACTTAACTACTCGAGTAGTTAAGTATTCAACCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017367.2-346s1c1
Sequence:CCGGCCAGAAACATTTGCTCTGGCACTCGAGTGCCAGAGCAAATGTTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017367.2-918s1c1
Sequence:CCGGCCTGCCTCTAAATTCCGTTTACTCGAGTAAACGGAATTTAGAGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017367.2-1104s1c1
Sequence:CCGGGTGCAAGCAAACCTCTGCTAACTCGAGTTAGCAGAGGTTTGCTTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017367.2-1174s1c1
Sequence:CCGGCGGCTCTATAATGAGGACAATCTCGAGATTGTCCTCATTATAGAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_017367.3-1289s21c1
Sequence:CCGGTACGATTGAACTGCTTCAGAACTCGAGTTCTGAAGCAGTTCAATCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_017367.3-1171s21c1
Sequence:CCGGCCAAGCAGCTGCTTCACTGTACTCGAGTACAGTGAAGCAGCTGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_017367.3-1571s21c1
Sequence:CCGGGTGCAAGCAAACCTCTGCTAACTCGAGTTAGCAGAGGTTTGCTTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017367.3-2129s21c1
Sequence:CCGGCCTCGGTTGAATACTTAACTACTCGAGTAGTTAAGTATTCAACCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_017367.3-1385s21c1
Sequence:CCGGCCTGCCTCTAAATTCCGTTTACTCGAGTAAACGGAATTTAGAGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017367
VALIDATED
CCNI MISSION shRNA shRNA Plasmid DNA
cyclin I
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017367.2-1662s1c1
Sequence:CCGGCCTCGGTTGAATACTTAACTACTCGAGTAGTTAAGTATTCAACCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017367.2-346s1c1
Sequence:CCGGCCAGAAACATTTGCTCTGGCACTCGAGTGCCAGAGCAAATGTTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017367.2-918s1c1
Sequence:CCGGCCTGCCTCTAAATTCCGTTTACTCGAGTAAACGGAATTTAGAGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017367.2-1104s1c1
Sequence:CCGGGTGCAAGCAAACCTCTGCTAACTCGAGTTAGCAGAGGTTTGCTTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017367.2-1174s1c1
Sequence:CCGGCGGCTCTATAATGAGGACAATCTCGAGATTGTCCTCATTATAGAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_017367.3-1289s21c1
Sequence:CCGGTACGATTGAACTGCTTCAGAACTCGAGTTCTGAAGCAGTTCAATCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_017367.3-1171s21c1
Sequence:CCGGCCAAGCAGCTGCTTCACTGTACTCGAGTACAGTGAAGCAGCTGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_017367.3-1571s21c1
Sequence:CCGGGTGCAAGCAAACCTCTGCTAACTCGAGTTAGCAGAGGTTTGCTTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017367.3-2129s21c1
Sequence:CCGGCCTCGGTTGAATACTTAACTACTCGAGTAGTTAAGTATTCAACCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_017367.3-1385s21c1
Sequence:CCGGCCTGCCTCTAAATTCCGTTTACTCGAGTAAACGGAATTTAGAGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017367
VALIDATED
CCNI MISSION shRNA Lentiviral Transduction Particles
cyclin I
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017367.2-1662s1c1
Sequence:CCGGCCTCGGTTGAATACTTAACTACTCGAGTAGTTAAGTATTCAACCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017367.2-346s1c1
Sequence:CCGGCCAGAAACATTTGCTCTGGCACTCGAGTGCCAGAGCAAATGTTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017367.2-918s1c1
Sequence:CCGGCCTGCCTCTAAATTCCGTTTACTCGAGTAAACGGAATTTAGAGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_017367.2-1104s1c1
Sequence:CCGGGTGCAAGCAAACCTCTGCTAACTCGAGTTAGCAGAGGTTTGCTTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017367.2-1174s1c1
Sequence:CCGGCGGCTCTATAATGAGGACAATCTCGAGATTGTCCTCATTATAGAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_017367.3-1289s21c1
Sequence:CCGGTACGATTGAACTGCTTCAGAACTCGAGTTCTGAAGCAGTTCAATCGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_017367.3-1171s21c1
Sequence:CCGGCCAAGCAGCTGCTTCACTGTACTCGAGTACAGTGAAGCAGCTGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_017367.3-1571s21c1
Sequence:CCGGGTGCAAGCAAACCTCTGCTAACTCGAGTTAGCAGAGGTTTGCTTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017367.3-2129s21c1
Sequence:CCGGCCTCGGTTGAATACTTAACTACTCGAGTAGTTAAGTATTCAACCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_017367.3-1385s21c1
Sequence:CCGGCCTGCCTCTAAATTCCGTTTACTCGAGTAAACGGAATTTAGAGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006835
VALIDATED
CCNI MISSION shRNA Bacterial Glycerol Stock
cyclin I
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006835.2-1559s1c1
Sequence:CCGGCGGCTCTATAATGAAGATAATCTCGAGATTATCTTCATTATAGAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006835.2-950s1c1
Sequence:CCGGGATAAGTTGAATTGGGATCTTCTCGAGAAGATCCCAATTCAACTTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006835.2-839s1c1
Sequence:CCGGGCCAAGACTGTTGAGGAAGATCTCGAGATCTTCCTCAACAGTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006835.2-1079s1c1
Sequence:CCGGGCAGTCCTTACCAAGCAACTACTCGAGTAGTTGCTTGGTAAGGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006835.2-1511s1c1
Sequence:CCGGCGCAAAGTAGAGGAAATGGAACTCGAGTTCCATTTCCTCTACTTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006835.2-1079s21c1
Sequence:CCGGGCAGTCCTTACCAAGCAACTACTCGAGTAGTTGCTTGGTAAGGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006835.2-839s21c1
Sequence:CCGGGCCAAGACTGTTGAGGAAGATCTCGAGATCTTCCTCAACAGTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006835.2-1559s21c1
Sequence:CCGGCGGCTCTATAATGAAGATAATCTCGAGATTATCTTCATTATAGAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006835.2-950s21c1
Sequence:CCGGGATAAGTTGAATTGGGATCTTCTCGAGAAGATCCCAATTCAACTTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006835
VALIDATED
CCNI MISSION shRNA shRNA Plasmid DNA
cyclin I
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006835.2-1559s1c1
Sequence:CCGGCGGCTCTATAATGAAGATAATCTCGAGATTATCTTCATTATAGAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006835.2-950s1c1
Sequence:CCGGGATAAGTTGAATTGGGATCTTCTCGAGAAGATCCCAATTCAACTTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006835.2-839s1c1
Sequence:CCGGGCCAAGACTGTTGAGGAAGATCTCGAGATCTTCCTCAACAGTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006835.2-1079s1c1
Sequence:CCGGGCAGTCCTTACCAAGCAACTACTCGAGTAGTTGCTTGGTAAGGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006835.2-1511s1c1
Sequence:CCGGCGCAAAGTAGAGGAAATGGAACTCGAGTTCCATTTCCTCTACTTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006835.2-1079s21c1
Sequence:CCGGGCAGTCCTTACCAAGCAACTACTCGAGTAGTTGCTTGGTAAGGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006835.2-839s21c1
Sequence:CCGGGCCAAGACTGTTGAGGAAGATCTCGAGATCTTCCTCAACAGTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006835.2-1559s21c1
Sequence:CCGGCGGCTCTATAATGAAGATAATCTCGAGATTATCTTCATTATAGAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006835.2-950s21c1
Sequence:CCGGGATAAGTTGAATTGGGATCTTCTCGAGAAGATCCCAATTCAACTTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006835
VALIDATED
CCNI MISSION shRNA Lentiviral Transduction Particles
cyclin I
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006835.2-1559s1c1
Sequence:CCGGCGGCTCTATAATGAAGATAATCTCGAGATTATCTTCATTATAGAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006835.2-950s1c1
Sequence:CCGGGATAAGTTGAATTGGGATCTTCTCGAGAAGATCCCAATTCAACTTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006835.2-839s1c1
Sequence:CCGGGCCAAGACTGTTGAGGAAGATCTCGAGATCTTCCTCAACAGTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006835.2-1079s1c1
Sequence:CCGGGCAGTCCTTACCAAGCAACTACTCGAGTAGTTGCTTGGTAAGGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006835.2-1511s1c1
Sequence:CCGGCGCAAAGTAGAGGAAATGGAACTCGAGTTCCATTTCCTCTACTTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006835.2-1079s21c1
Sequence:CCGGGCAGTCCTTACCAAGCAACTACTCGAGTAGTTGCTTGGTAAGGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006835.2-839s21c1
Sequence:CCGGGCCAAGACTGTTGAGGAAGATCTCGAGATCTTCCTCAACAGTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006835.2-1559s21c1
Sequence:CCGGCGGCTCTATAATGAAGATAATCTCGAGATTATCTTCATTATAGAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006835.2-950s21c1
Sequence:CCGGGATAAGTTGAATTGGGATCTTCTCGAGAAGATCCCAATTCAACTTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)