EMAIL THIS PAGE TO A FRIEND

CD226

CD226 molecule

107 Gene Product Result for
Synonyms: DNAM-1 DNAM1 PTA1 TLiSA1
UniProtKB ID: Q15762, B2R818
Gene ID:
Human(10666) Summary: This gene encodes a glycoprotein expressed on the surface of NK cells, platelets, monocytes and a subset of T cells. It is a member of the Ig-superfamily containing 2 Ig-like domains of the V-set. The protein mediates cellular adhesion of platelets and megakaryocytic cells to vascular endothelial cells. The protein also plays a role in megakaryocytic cell maturation. [provided by RefSeq, Jul 2008]
Mouse(225825) CD226 antigen
Rat(307199) CD226 molecule
Zebrafish(791164) CD226 molecule
cow(615496) CD226 molecule
domestic cat(101094795) CD226 molecule
dog(609196) CD226 molecule
chicken(772097) CD226 molecule
naked mole-rat(101717040) CD226 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006566 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006566 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006566 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178687 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178687 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178687 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006566 Rosetta Predictions human pricing
NM_001107370 Rosetta Predictions rat pricing
NM_001039148 Rosetta Predictions mouse pricing
NM_001039149 Rosetta Predictions mouse pricing
NM_178687 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006566 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077002 predicted 460
2 SASI_Hs02_00341837 predicted 789
3 SASI_Hs01_00077003 predicted 381
4 SASI_Hs01_00077004 predicted 812
5 SASI_Hs02_00341838 predicted 1182
6 SASI_Hs01_00077006 predicted 1019
7 SASI_Hs01_00077008 predicted 1116
8 SASI_Hs01_00077007 predicted 1191
9 SASI_Hs01_00077009 predicted 1110
10 SASI_Hs01_00077010 predicted 573
11 SASI_Hs01_00077005 predicted 556
12 SASI_Hs01_00077011 predicted 943
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107370 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228155 predicted 914
2 SASI_Rn02_00228156 predicted 651
3 SASI_Rn02_00228157 predicted 421
4 SASI_Rn02_00228158 predicted 675
5 SASI_Rn02_00228159 predicted 412
6 SASI_Rn02_00228160 predicted 646
7 SASI_Rn02_00228161 predicted 254
8 SASI_Rn02_00228162 predicted 304
9 SASI_Rn02_00228163 predicted 389
10 SASI_Rn02_00228164 predicted 1062
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039148 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035596 predicted 436
2 SASI_Mm01_00035597 predicted 302
3 SASI_Mm01_00035598 predicted 505
4 SASI_Mm01_00035599 predicted 327
5 SASI_Mm01_00035600 predicted 555
6 SASI_Mm01_00035601 predicted 457
7 SASI_Mm01_00035602 predicted 389
8 SASI_Mm01_00035603 predicted 720
9 SASI_Mm01_00035604 predicted 407
10 SASI_Mm01_00035605 predicted 426
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039149 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289857 predicted 1356
2 SASI_Mm02_00289858 predicted 502
3 SASI_Mm02_00289859 predicted 1376
4 SASI_Mm02_00289860 predicted 615
5 SASI_Mm02_00289861 predicted 767
6 SASI_Mm02_00289862 predicted 747
7 SASI_Mm02_00289863 predicted 516
8 SASI_Mm02_00289864 predicted 681
9 SASI_Mm02_00289865 predicted 1309
10 SASI_Mm02_00289866 predicted 1218
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178687 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038252 predicted 1697
2 SASI_Mm02_00349163 predicted 844
3 SASI_Mm01_00038253 predicted 1715
4 SASI_Mm02_00349164 predicted 951
5 SASI_Mm02_00349165 predicted 1101
6 SASI_Mm02_00349166 predicted 1088
7 SASI_Mm02_00349167 predicted 857
8 SASI_Mm02_00349168 predicted 1017
9 SASI_Mm01_00038254 predicted 1643
10 SASI_Mm02_00349169 predicted 1564
11 SASI_Mm01_00038255 predicted 1670
12 SASI_Mm01_00038256 predicted 1710
13 SASI_Mm01_00038257 predicted 1653
14 SASI_Mm01_00038258 predicted 1672
15 SASI_Mm01_00038259 predicted 1711
16 SASI_Mm01_00038260 predicted 436
17 SASI_Mm01_00038261 predicted 303
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006566
CD226 MISSION shRNA Bacterial Glycerol Stock
CD226 molecule
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006566.1-467s1c1
Sequence:CCGGGCTTCCAATAACATGACTCTTCTCGAGAAGAGTCATGTTATTGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006566.1-1125s1c1
Sequence:CCGGCCGGTCAACCTACCAATCAATCTCGAGATTGATTGGTAGGTTGACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006566.1-781s1c1
Sequence:CCGGCCCAAGACAAATAGTGAGCAACTCGAGTTGCTCACTATTTGTCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006566.1-296s1c1
Sequence:CCGGGCCGAGAACATGTCTCTAGAACTCGAGTTCTAGAGACATGTTCTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006566.1-1196s1c1
Sequence:CCGGCGCAGACCAAAGACTAGAGTTCTCGAGAACTCTAGTCTTTGGTCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006566.2-1213s21c1
Sequence:CCGGATGATACAAGAGAGGATATTTCTCGAGAAATATCCTCTCTTGTATCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006566.2-1533s21c1
Sequence:CCGGGCTTTGGGCAAGGGCTATTTACTCGAGTAAATAGCCCTTGCCCAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416820    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006566.2-1320s21c1
Sequence:CCGGGTACTCATGCATGGATCTTTACTCGAGTAAAGATCCATGCATGAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006566.2-385s21c1
Sequence:CCGGATCCATCAATGGGCATCTTAACTCGAGTTAAGATGCCCATTGATGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006566
CD226 MISSION shRNA shRNA Plasmid DNA
CD226 molecule
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006566.1-467s1c1
Sequence:CCGGGCTTCCAATAACATGACTCTTCTCGAGAAGAGTCATGTTATTGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006566.1-1125s1c1
Sequence:CCGGCCGGTCAACCTACCAATCAATCTCGAGATTGATTGGTAGGTTGACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006566.1-781s1c1
Sequence:CCGGCCCAAGACAAATAGTGAGCAACTCGAGTTGCTCACTATTTGTCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006566.1-296s1c1
Sequence:CCGGGCCGAGAACATGTCTCTAGAACTCGAGTTCTAGAGACATGTTCTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006566.1-1196s1c1
Sequence:CCGGCGCAGACCAAAGACTAGAGTTCTCGAGAACTCTAGTCTTTGGTCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006566.2-1213s21c1
Sequence:CCGGATGATACAAGAGAGGATATTTCTCGAGAAATATCCTCTCTTGTATCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006566.2-1533s21c1
Sequence:CCGGGCTTTGGGCAAGGGCTATTTACTCGAGTAAATAGCCCTTGCCCAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416820    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006566.2-1320s21c1
Sequence:CCGGGTACTCATGCATGGATCTTTACTCGAGTAAAGATCCATGCATGAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006566.2-385s21c1
Sequence:CCGGATCCATCAATGGGCATCTTAACTCGAGTTAAGATGCCCATTGATGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006566
CD226 MISSION shRNA Lentiviral Transduction Particles
CD226 molecule
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006566.1-467s1c1
Sequence:CCGGGCTTCCAATAACATGACTCTTCTCGAGAAGAGTCATGTTATTGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006566.1-1125s1c1
Sequence:CCGGCCGGTCAACCTACCAATCAATCTCGAGATTGATTGGTAGGTTGACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006566.1-781s1c1
Sequence:CCGGCCCAAGACAAATAGTGAGCAACTCGAGTTGCTCACTATTTGTCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006566.1-296s1c1
Sequence:CCGGGCCGAGAACATGTCTCTAGAACTCGAGTTCTAGAGACATGTTCTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006566.1-1196s1c1
Sequence:CCGGCGCAGACCAAAGACTAGAGTTCTCGAGAACTCTAGTCTTTGGTCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006566.2-1213s21c1
Sequence:CCGGATGATACAAGAGAGGATATTTCTCGAGAAATATCCTCTCTTGTATCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006566.2-1533s21c1
Sequence:CCGGGCTTTGGGCAAGGGCTATTTACTCGAGTAAATAGCCCTTGCCCAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416820    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006566.2-1320s21c1
Sequence:CCGGGTACTCATGCATGGATCTTTACTCGAGTAAAGATCCATGCATGAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006566.2-385s21c1
Sequence:CCGGATCCATCAATGGGCATCTTAACTCGAGTTAAGATGCCCATTGATGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178687
CD226 MISSION shRNA Bacterial Glycerol Stock
CD226 molecule
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178687.1-410s1c1
Sequence:CCGGCCTAAGACAAACAAGGAGCAACTCGAGTTGCTCCTTGTTTGTCTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178687.1-458s1c1
Sequence:CCGGCCTCATCATTCCAAATGCCATCTCGAGATGGCATTTGGAATGATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178687.1-271s1c1
Sequence:CCGGGACAAGATGTCACACTCACTTCTCGAGAAGTGAGTGTGACATCTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178687.1-394s1c1
Sequence:CCGGGATACACTTCAAAGTACCTAACTCGAGTTAGGTACTTTGAAGTGTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178687.1-366s1c1
Sequence:CCGGGCTTCCTGTAACCTATCTCAACTCGAGTTGAGATAGGTTACAGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178687
CD226 MISSION shRNA shRNA Plasmid DNA
CD226 molecule
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178687.1-410s1c1
Sequence:CCGGCCTAAGACAAACAAGGAGCAACTCGAGTTGCTCCTTGTTTGTCTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178687.1-458s1c1
Sequence:CCGGCCTCATCATTCCAAATGCCATCTCGAGATGGCATTTGGAATGATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178687.1-271s1c1
Sequence:CCGGGACAAGATGTCACACTCACTTCTCGAGAAGTGAGTGTGACATCTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178687.1-394s1c1
Sequence:CCGGGATACACTTCAAAGTACCTAACTCGAGTTAGGTACTTTGAAGTGTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178687.1-366s1c1
Sequence:CCGGGCTTCCTGTAACCTATCTCAACTCGAGTTGAGATAGGTTACAGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178687
CD226 MISSION shRNA Lentiviral Transduction Particles
CD226 molecule
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178687.1-410s1c1
Sequence:CCGGCCTAAGACAAACAAGGAGCAACTCGAGTTGCTCCTTGTTTGTCTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178687.1-458s1c1
Sequence:CCGGCCTCATCATTCCAAATGCCATCTCGAGATGGCATTTGGAATGATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178687.1-271s1c1
Sequence:CCGGGACAAGATGTCACACTCACTTCTCGAGAAGTGAGTGTGACATCTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178687.1-394s1c1
Sequence:CCGGGATACACTTCAAAGTACCTAACTCGAGTTAGGTACTTTGAAGTGTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178687.1-366s1c1
Sequence:CCGGGCTTCCTGTAACCTATCTCAACTCGAGTTGAGATAGGTTACAGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)