EMAIL THIS PAGE TO A FRIEND

CD244

CD244 molecule, natural killer cell receptor 2B4

137 Gene Product Result for
Synonyms: 2B4 NAIL NKR2B4 Nmrk SLAMF4
Gene ID:
Human(51744) Summary: This gene encodes a cell surface receptor expressed on natural killer (NK) cells (and some T cells) that mediate non-major histocompatibility complex (MHC) restricted killing. The interaction between NK-cell and target cells via this receptor is thought to modulate NK-cell cytolytic activity. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
Mouse(18106) CD244 natural killer cell receptor 2B4
Rat(64025) Cd244 molecule, natural killer cell receptor 2B4
chicken(425935) CD244 molecule, natural killer cell receptor 2B4
dog(488644) CD244 molecule, natural killer cell receptor 2B4
cow(513468) CD244 molecule, natural killer cell receptor 2B4
domestic cat(101089073) CD244 molecule, natural killer cell receptor 2B4
domestic guinea pig(100723163) CD244 molecule, natural killer cell receptor 2B4
naked mole-rat(101713886) CD244 molecule, natural killer cell receptor 2B4
sheep(101121900) CD244 molecule, natural killer cell receptor 2B4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0599 Human CD244 / Natural Killer Cell Receptor 2B4 ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016382 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016382 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016382 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018729 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018729 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018729 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU069051 MISSION® esiRNA esiRNA human CD244 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016382 Rosetta Predictions human pricing
NM_022259 Rosetta Predictions rat pricing
NM_018729 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016382 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086026 predicted 1233
2 SASI_Hs01_00086028 predicted 729
3 SASI_Hs01_00086029 predicted 1168
4 SASI_Hs01_00086030 predicted 1178
5 SASI_Hs01_00086031 predicted 288
6 SASI_Hs02_00349378 predicted 856
7 SASI_Hs01_00086032 predicted 398
8 SASI_Hs01_00086033 predicted 1089
9 SASI_Hs01_00086034 predicted 768
10 SASI_Hs02_00349379 predicted 363
11 SASI_Hs01_00086027 predicted 1354
12 SASI_Hs01_00086035 predicted 387
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022259 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055943 predicted 258
2 SASI_Rn01_00055945 predicted 1009
3 SASI_Rn01_00055946 predicted 1006
4 SASI_Rn01_00055947 predicted 982
5 SASI_Rn01_00055948 predicted 1084
6 SASI_Rn01_00055949 predicted 1002
7 SASI_Rn01_00055950 predicted 1051
8 SASI_Rn01_00055951 predicted 1074
9 SASI_Rn02_00263053 predicted 1018
10 SASI_Rn02_00263054 predicted 275
11 SASI_Rn01_00055944 predicted 1077
12 SASI_Rn01_00055952 predicted 1062
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018729 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165574 predicted 485
2 SASI_Mm01_00165575 predicted 780
3 SASI_Mm01_00165576 predicted 705
4 SASI_Mm01_00165577 predicted 1310
5 SASI_Mm02_00323958 predicted 1381
6 SASI_Mm01_00165579 predicted 656
7 SASI_Mm01_00165582 predicted 552
8 SASI_Mm02_00323959 predicted 737
9 SASI_Mm01_00165583 predicted 403
10 SASI_Mm02_00323960 predicted 886
11 SASI_Mm01_00165578 predicted 821
12 SASI_Mm01_00165580 predicted 198
13 SASI_Mm01_00165581 predicted 1214
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016382
CD244 MISSION shRNA Bacterial Glycerol Stock
CD244 molecule, natural killer cell receptor 2B4
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000057528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016382.2-1282s1c1
Sequence:CCGGGCAGCAATTCTCACCTTTCTTCTCGAGAAGAAAGGTGAGAATTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016382.2-865s1c1
Sequence:CCGGCGTGATTCTAAGCGCACTGTTCTCGAGAACAGTGCGCTTAGAATCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016382.2-283s1c1
Sequence:CCGGGCCTCTTCAGTTACAACCAAACTCGAGTTTGGTTGTAACTGAAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016382.2-1165s1c1
Sequence:CCGGCCCTTCCTTCAATAGCACTATCTCGAGATAGTGCTATTGAAGGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016382
CD244 MISSION shRNA shRNA Plasmid DNA
CD244 molecule, natural killer cell receptor 2B4
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000057528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016382.2-1282s1c1
Sequence:CCGGGCAGCAATTCTCACCTTTCTTCTCGAGAAGAAAGGTGAGAATTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016382.2-865s1c1
Sequence:CCGGCGTGATTCTAAGCGCACTGTTCTCGAGAACAGTGCGCTTAGAATCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016382.2-283s1c1
Sequence:CCGGGCCTCTTCAGTTACAACCAAACTCGAGTTTGGTTGTAACTGAAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016382.2-1165s1c1
Sequence:CCGGCCCTTCCTTCAATAGCACTATCTCGAGATAGTGCTATTGAAGGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016382
CD244 MISSION shRNA Lentiviral Transduction Particles
CD244 molecule, natural killer cell receptor 2B4
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000057528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016382.2-1282s1c1
Sequence:CCGGGCAGCAATTCTCACCTTTCTTCTCGAGAAGAAAGGTGAGAATTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016382.2-865s1c1
Sequence:CCGGCGTGATTCTAAGCGCACTGTTCTCGAGAACAGTGCGCTTAGAATCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016382.2-283s1c1
Sequence:CCGGGCCTCTTCAGTTACAACCAAACTCGAGTTTGGTTGTAACTGAAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016382.2-1165s1c1
Sequence:CCGGCCCTTCCTTCAATAGCACTATCTCGAGATAGTGCTATTGAAGGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018729
CD244 MISSION shRNA Bacterial Glycerol Stock
CD244 molecule, natural killer cell receptor 2B4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018729.1-1568s1c1
Sequence:CCGGGCTGGAGATGATGTAGTTTATCTCGAGATAAACTACATCATCTCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018729.1-246s1c1
Sequence:CCGGGCCTTCCAACATACAGACAAACTCGAGTTTGTCTGTATGTTGGAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018729.1-888s1c1
Sequence:CCGGGCAGTTACAGTTCAGCCCTAACTCGAGTTAGGGCTGAACTGTAACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018729.1-1118s1c1
Sequence:CCGGGCAAGCCTTCTGATTCCACATCTCGAGATGTGGAATCAGAAGGCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018729.1-902s1c1
Sequence:CCGGGCCCTAAGGAACCTTTGACAACTCGAGTTGTCAAAGGTTCCTTAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018729
CD244 MISSION shRNA shRNA Plasmid DNA
CD244 molecule, natural killer cell receptor 2B4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018729.1-1568s1c1
Sequence:CCGGGCTGGAGATGATGTAGTTTATCTCGAGATAAACTACATCATCTCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018729.1-246s1c1
Sequence:CCGGGCCTTCCAACATACAGACAAACTCGAGTTTGTCTGTATGTTGGAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018729.1-888s1c1
Sequence:CCGGGCAGTTACAGTTCAGCCCTAACTCGAGTTAGGGCTGAACTGTAACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018729.1-1118s1c1
Sequence:CCGGGCAAGCCTTCTGATTCCACATCTCGAGATGTGGAATCAGAAGGCTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018729.1-902s1c1
Sequence:CCGGGCCCTAAGGAACCTTTGACAACTCGAGTTGTCAAAGGTTCCTTAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018729
CD244 MISSION shRNA Lentiviral Transduction Particles
CD244 molecule, natural killer cell receptor 2B4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018729.1-1568s1c1
Sequence:CCGGGCTGGAGATGATGTAGTTTATCTCGAGATAAACTACATCATCTCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018729.1-246s1c1
Sequence:CCGGGCCTTCCAACATACAGACAAACTCGAGTTTGTCTGTATGTTGGAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018729.1-888s1c1
Sequence:CCGGGCAGTTACAGTTCAGCCCTAACTCGAGTTAGGGCTGAACTGTAACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018729.1-1118s1c1
Sequence:CCGGGCAAGCCTTCTGATTCCACATCTCGAGATGTGGAATCAGAAGGCTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018729.1-902s1c1
Sequence:CCGGGCCCTAAGGAACCTTTGACAACTCGAGTTGTCAAAGGTTCCTTAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)