EMAIL THIS PAGE TO A FRIEND

CD55

CD55 molecule, decay accelerating factor for complement (Cromer blood group)

175 Gene Product Result for
Synonyms: CR CROM DAF TC
Gene ID:
Human(1604) Summary: This gene encodes a protein involved in the regulation of the complement cascade. The encoded glycoprotein is also known as the decay-accelerating factor (DAF); binding of DAF to complement proteins accelerates their decay, disrupting the cascade and preventing damage to host cells. Antigens present on the DAF glycoprotein constitute the Cromer blood group system (CROM). Two alternatively spliced transcripts encoding different proteins have been identified. The predominant transcript encodes a membrane-bound protein expressed on cells exposed to plasma component proteins but an alternatively spliced transcript produces a soluble protein present at much lower levels. Additional, alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Mouse(13136) CD55 antigen
Rat(64036) Cd55 molecule
chicken(419852) CD55 molecule, decay accelerating factor for complement (Cromer blood group)
cow(518609) CD55 molecule, decay accelerating factor for complement (Cromer blood group)
domestic cat(101094644) CD55 molecule, decay accelerating factor for complement (Cromer blood group)
dog(609307) CD55 molecule, decay accelerating factor for complement (Cromer blood group)
sheep(101120257) CD55 molecule, decay accelerating factor for complement (Cromer blood group)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
GW22692 Anti-CD55 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB1405695 Anti-CD55 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA002190 Anti-CD55 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA024386 Anti-CD55 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4500614 Anti-CD55 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
SAB4700249 Monoclonal Anti-CD55 antibody produced in mouse clone MEM-118, purified immunoglobulin, buffered aqueous solution nonhuman primates, human
flow cytometry pricing
SAB4700250 Monoclonal Anti-CD55-Biotin antibody produced in mouse clone MEM-118, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry pricing
SAB4700251 Monoclonal Anti-CD55-FITC antibody produced in mouse clone MEM-118, purified immunoglobulin, buffered aqueous solution nonhuman primates, human
flow cytometry pricing
SAB4700698 Monoclonal Anti-CD55-PE antibody produced in mouse clone MEM-118, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry, immunohistochemistry, immunoprecipitation (IP) pricing
WH0001604M1 Monoclonal Anti-DAF antibody produced in mouse clone 1G3, purified immunoglobulin, buffered aqueous solution human
ELISA, proximity ligation assay, western blot pricing
SAB1403721 Monoclonal Anti-DAF antibody produced in mouse clone 1D7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB1345 Human CD55 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010016 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010016 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010016 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000574 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000574 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000574 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000574 Rosetta Predictions human pricing
NM_001114752 Rosetta Predictions human pricing
NM_022269 Rosetta Predictions rat pricing
NM_010016 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000574 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302823 predicted 618
2 SASI_Hs01_00117919 predicted 1030
3 SASI_Hs02_00302824 predicted 853
4 SASI_Hs02_00302825 predicted 781
5 SASI_Hs02_00302826 predicted 1038
6 SASI_Hs02_00302827 predicted 696
7 SASI_Hs02_00302828 predicted 611
8 SASI_Hs01_00117922 predicted 1069
9 SASI_Hs01_00117923 predicted 825
10 SASI_Hs01_00117924 predicted 711
11 SASI_Hs01_00117918 predicted 1302
12 SASI_Hs01_00117920 predicted 419
13 SASI_Hs01_00117921 predicted 515
14 SASI_Hs01_00117925 predicted 377
15 SASI_Hs01_00117926 predicted 482
16 SASI_Hs01_00117927 predicted 509
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114752 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326804 predicted 620
2 SASI_Hs02_00326805 predicted 1030
3 SASI_Hs02_00326806 predicted 855
4 SASI_Hs02_00326807 predicted 776
5 SASI_Hs02_00326808 predicted 1035
6 SASI_Hs02_00326809 predicted 695
7 SASI_Hs02_00326810 predicted 1692
8 SASI_Hs02_00326811 predicted 616
9 SASI_Hs02_00326812 predicted 1063
10 SASI_Hs02_00326813 predicted 819
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022269 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110692 predicted 486
2 SASI_Rn01_00110693 predicted 963
3 SASI_Rn01_00110694 predicted 1224
4 SASI_Rn01_00110695 predicted 655
5 SASI_Rn01_00110696 predicted 345
6 SASI_Rn01_00110697 predicted 1051
7 SASI_Rn01_00110698 predicted 1267
8 SASI_Rn01_00110699 predicted 1061
9 SASI_Rn01_00110700 predicted 1039
10 SASI_Rn02_00263075 predicted 1011
11 SASI_Rn01_00110701 predicted 1032
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010016 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137590 predicted 844
2 SASI_Mm02_00317628 predicted 1250
3 SASI_Mm02_00317629 predicted 1309
4 SASI_Mm02_00317630 predicted 1248
5 SASI_Mm01_00137593 predicted 817
6 SASI_Mm01_00137594 predicted 1103
7 SASI_Mm02_00317631 predicted 1090
8 SASI_Mm02_00317632 predicted 1311
9 SASI_Mm02_00317633 predicted 1303
10 SASI_Mm01_00137598 predicted 949
11 SASI_Mm01_00137589 predicted 1046
12 SASI_Mm01_00137591 predicted 207
13 SASI_Mm01_00137592 predicted 826
14 SASI_Mm01_00137595 predicted 273
15 SASI_Mm01_00137596 predicted 821
16 SASI_Mm01_00137597 predicted 971
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010016
VALIDATED
CD55 MISSION shRNA Bacterial Glycerol Stock
CD55 molecule, decay accelerating factor for complement (Cromer blood group)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010016.1-631s1c1
Sequence:CCGGGTCACAGGAAATACTGTTGATCTCGAGATCAACAGTATTTCCTGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010016.1-885s1c1
Sequence:CCGGCCCAACGAAGAAACCAACAATCTCGAGATTGTTGGTTTCTTCGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010016.1-1033s1c1
Sequence:CCGGCCTGTTACCAAGACAACAGTACTCGAGTACTGTTGTCTTGGTAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010016.1-789s1c1
Sequence:CCGGCCTGGTTGGAAATGCTAGCATCTCGAGATGCTAGCATTTCCAACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010016.1-1055s1c1
Sequence:CCGGGTCATCCAATAAGAACATCTACTCGAGTAGATGTTCTTATTGGATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010016.2-1239s21c1
Sequence:CCGGACATAGCCAACGAAGAGTTACCTCGAGGTAACTCTTCGTTGGCTATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010016.2-1588s21c1
Sequence:CCGGGTTAGTCTAGCTTATGATTAACTCGAGTTAATCATAAGCTAGACTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010016
VALIDATED
CD55 MISSION shRNA shRNA Plasmid DNA
CD55 molecule, decay accelerating factor for complement (Cromer blood group)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010016.1-631s1c1
Sequence:CCGGGTCACAGGAAATACTGTTGATCTCGAGATCAACAGTATTTCCTGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010016.1-885s1c1
Sequence:CCGGCCCAACGAAGAAACCAACAATCTCGAGATTGTTGGTTTCTTCGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010016.1-1033s1c1
Sequence:CCGGCCTGTTACCAAGACAACAGTACTCGAGTACTGTTGTCTTGGTAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010016.1-789s1c1
Sequence:CCGGCCTGGTTGGAAATGCTAGCATCTCGAGATGCTAGCATTTCCAACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010016.1-1055s1c1
Sequence:CCGGGTCATCCAATAAGAACATCTACTCGAGTAGATGTTCTTATTGGATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010016.2-1239s21c1
Sequence:CCGGACATAGCCAACGAAGAGTTACCTCGAGGTAACTCTTCGTTGGCTATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010016.2-1588s21c1
Sequence:CCGGGTTAGTCTAGCTTATGATTAACTCGAGTTAATCATAAGCTAGACTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010016
VALIDATED
CD55 MISSION shRNA Lentiviral Transduction Particles
CD55 molecule, decay accelerating factor for complement (Cromer blood group)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010016.1-631s1c1
Sequence:CCGGGTCACAGGAAATACTGTTGATCTCGAGATCAACAGTATTTCCTGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010016.1-885s1c1
Sequence:CCGGCCCAACGAAGAAACCAACAATCTCGAGATTGTTGGTTTCTTCGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010016.1-1033s1c1
Sequence:CCGGCCTGTTACCAAGACAACAGTACTCGAGTACTGTTGTCTTGGTAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010016.1-789s1c1
Sequence:CCGGCCTGGTTGGAAATGCTAGCATCTCGAGATGCTAGCATTTCCAACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010016.1-1055s1c1
Sequence:CCGGGTCATCCAATAAGAACATCTACTCGAGTAGATGTTCTTATTGGATGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010016.2-1239s21c1
Sequence:CCGGACATAGCCAACGAAGAGTTACCTCGAGGTAACTCTTCGTTGGCTATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010016.2-1588s21c1
Sequence:CCGGGTTAGTCTAGCTTATGATTAACTCGAGTTAATCATAAGCTAGACTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000574
VALIDATED
CD55 MISSION shRNA Bacterial Glycerol Stock
CD55 molecule, decay accelerating factor for complement (Cromer blood group)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_000574.2-1208s1c1
Sequence:CCGGCCACACCAAATGCTCAAGCAACTCGAGTTGCTTGAGCATTTGGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_000574.2-1019s1c1
Sequence:CCGGCCATGATTGGAGAGCACTCTACTCGAGTAGAGTGCTCTCCAATCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_000574.2-414s1c1
Sequence:CCGGCGAGGATACTGTAATAACGTACTCGAGTACGTTATTACAGTATCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_000574.2-555s1c1
Sequence:CCGGGCTAAATTCTGCATCCCTCAACTCGAGTTGAGGGATGCAGAATTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000574.2-1145s1c1
Sequence:CCGGCCACAGTAAATGTTCCAACTACTCGAGTAGTTGGAACATTTACTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000574.3-1011s21c1
Sequence:CCGGACGTGACCATTATGGATATAGCTCGAGCTATATCCATAATGGTCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255378    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000574.3-2161s21c1
Sequence:CCGGTCGAGATGTCCATAGTCAAATCTCGAGATTTGACTATGGACATCTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_000574.3-745s21c1
Sequence:CCGGTGGTCCACAGCAGTCGAATTTCTCGAGAAATTCGACTGCTGTGGACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000574.3-788s21c1
Sequence:CCGGATCCGGGAGAAATACGAAATGCTCGAGCATTTCGTATTTCTCCCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000574.3-817s21c1
Sequence:CCGGGATGTACCAGGTGGCATATTACTCGAGTAATATGCCACCTGGTACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000574
VALIDATED
CD55 MISSION shRNA shRNA Plasmid DNA
CD55 molecule, decay accelerating factor for complement (Cromer blood group)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_000574.2-1208s1c1
Sequence:CCGGCCACACCAAATGCTCAAGCAACTCGAGTTGCTTGAGCATTTGGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_000574.2-1019s1c1
Sequence:CCGGCCATGATTGGAGAGCACTCTACTCGAGTAGAGTGCTCTCCAATCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_000574.2-414s1c1
Sequence:CCGGCGAGGATACTGTAATAACGTACTCGAGTACGTTATTACAGTATCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_000574.2-555s1c1
Sequence:CCGGGCTAAATTCTGCATCCCTCAACTCGAGTTGAGGGATGCAGAATTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000574.2-1145s1c1
Sequence:CCGGCCACAGTAAATGTTCCAACTACTCGAGTAGTTGGAACATTTACTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000574.3-1011s21c1
Sequence:CCGGACGTGACCATTATGGATATAGCTCGAGCTATATCCATAATGGTCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255378    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000574.3-2161s21c1
Sequence:CCGGTCGAGATGTCCATAGTCAAATCTCGAGATTTGACTATGGACATCTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_000574.3-745s21c1
Sequence:CCGGTGGTCCACAGCAGTCGAATTTCTCGAGAAATTCGACTGCTGTGGACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000574.3-788s21c1
Sequence:CCGGATCCGGGAGAAATACGAAATGCTCGAGCATTTCGTATTTCTCCCGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000574.3-817s21c1
Sequence:CCGGGATGTACCAGGTGGCATATTACTCGAGTAATATGCCACCTGGTACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000574
VALIDATED
CD55 MISSION shRNA Lentiviral Transduction Particles
CD55 molecule, decay accelerating factor for complement (Cromer blood group)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_000574.2-1208s1c1
Sequence:CCGGCCACACCAAATGCTCAAGCAACTCGAGTTGCTTGAGCATTTGGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_000574.2-1019s1c1
Sequence:CCGGCCATGATTGGAGAGCACTCTACTCGAGTAGAGTGCTCTCCAATCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_000574.2-414s1c1
Sequence:CCGGCGAGGATACTGTAATAACGTACTCGAGTACGTTATTACAGTATCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_000574.2-555s1c1
Sequence:CCGGGCTAAATTCTGCATCCCTCAACTCGAGTTGAGGGATGCAGAATTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000574.2-1145s1c1
Sequence:CCGGCCACAGTAAATGTTCCAACTACTCGAGTAGTTGGAACATTTACTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000574.3-1011s21c1
Sequence:CCGGACGTGACCATTATGGATATAGCTCGAGCTATATCCATAATGGTCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255378    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000574.3-2161s21c1
Sequence:CCGGTCGAGATGTCCATAGTCAAATCTCGAGATTTGACTATGGACATCTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_000574.3-745s21c1
Sequence:CCGGTGGTCCACAGCAGTCGAATTTCTCGAGAAATTCGACTGCTGTGGACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000574.3-788s21c1
Sequence:CCGGATCCGGGAGAAATACGAAATGCTCGAGCATTTCGTATTTCTCCCGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000574.3-817s21c1
Sequence:CCGGGATGTACCAGGTGGCATATTACTCGAGTAATATGCCACCTGGTACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)