EMAIL THIS PAGE TO A FRIEND

CD70

CD70 molecule

79 Gene Product Result for
Synonyms: CD27L CD27LG TNFSF7
UniProtKB ID: P32970, Q96J57
Gene ID:
Human(970) Summary: The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This cytokine is a ligand for TNFRSF27/CD27. It is a surface antigen on activated, but not on resting, T and B lymphocytes. It induces proliferation of costimulated T cells, enhances the generation of cytolytic T cells, and contributes to T cell activation. This cytokine is also reported to play a role in regulating B-cell activation, cytotoxic function of natural killer cells, and immunoglobulin sythesis. [provided by RefSeq, Jul 2008]
Mouse(21948) CD70 antigen
Rat(301132) Cd70 molecule
cow(522074) CD70 molecule
dog(485018) CD70 molecule
domestic cat(101087455) CD70 molecule
sheep(101105074) CD70 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001252 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001252 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001252 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011617 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011617 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011617 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU035541 MISSION® esiRNA esiRNA human CD70 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001252 Rosetta Predictions human pricing
NM_001106878 Rosetta Predictions rat pricing
XM_217320 Rosetta Predictions rat pricing
NM_011617 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001252 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056359 predicted 447
2 SASI_Hs02_00331431 predicted 394
3 SASI_Hs01_00056360 predicted 425
4 SASI_Hs01_00056361 predicted 448
5 SASI_Hs01_00056362 predicted 212
6 SASI_Hs01_00056363 predicted 431
7 SASI_Hs01_00056365 predicted 453
8 SASI_Hs01_00056366 predicted 433
9 SASI_Hs01_00056367 predicted 428
10 SASI_Hs01_00056368 predicted 439
11 SASI_Hs01_00056364 predicted 492
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106878 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223296 predicted 426
2 SASI_Rn02_00223297 predicted 306
3 SASI_Rn02_00223298 predicted 466
4 SASI_Rn02_00223299 predicted 480
5 SASI_Rn02_00223300 predicted 454
6 SASI_Rn02_00223301 predicted 308
7 SASI_Rn02_00223302 predicted 452
8 SASI_Rn02_00223303 predicted 429
9 SASI_Rn02_00223304 predicted 433
10 SASI_Rn02_00223305 predicted 228
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217320 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00182447 predicted 435
2 SASI_Rn01_00182448 predicted 287
3 SASI_Rn01_00182449 predicted 374
4 SASI_Rn01_00182450 predicted 252
5 SASI_Rn01_00182451 predicted 410
6 SASI_Rn01_00182452 predicted 431
7 SASI_Rn01_00182453 predicted 407
8 SASI_Rn01_00182454 predicted 259
9 SASI_Rn01_00182455 predicted 336
10 SASI_Rn01_00182456 predicted 251
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011617 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321054 predicted 462
2 SASI_Mm01_00055202 predicted 501
3 SASI_Mm01_00055203 predicted 479
4 SASI_Mm01_00055205 predicted 290
5 SASI_Mm01_00055206 predicted 342
6 SASI_Mm02_00321055 predicted 253
7 SASI_Mm01_00055207 predicted 280
8 SASI_Mm01_00055208 predicted 494
9 SASI_Mm01_00055209 predicted 350
10 SASI_Mm01_00055210 predicted 478
11 SASI_Mm01_00055204 predicted 462
12 SASI_Mm01_00055211 predicted 295
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001252
CD70 MISSION shRNA Bacterial Glycerol Stock
CD70 molecule
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011202    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001252.2-738s1c1
Sequence:CCGGGCTGCTGATTAGGGTTTTTTACTCGAGTAAAAAACCCTAATCAGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001252.2-444s1c1
Sequence:CCGGCCATCGTGATGGCATCTACATCTCGAGATGTAGATGCCATCACGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001252.2-686s1c1
Sequence:CCGGGAAACACTGATGAGACCTTCTCTCGAGAGAAGGTCTCATCAGTGTTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001252.2-453s1c1
Sequence:CCGGTGGCATCTACATGGTACACATCTCGAGATGTGTACCATGTAGATGCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001252.2-319s1c1
Sequence:CCGGGTAGCTGAGCTGCAGCTGAATCTCGAGATTCAGCTGCAGCTCAGCTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001252.3-433s21c1
Sequence:CCGGCAGCTACGTATCCATCGTGATCTCGAGATCACGATGGATACGTAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001252.3-644s21c1
Sequence:CCGGACACACTCTGCACCAACCTCACTCGAGTGAGGTTGGTGCAGAGTGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001252
CD70 MISSION shRNA shRNA Plasmid DNA
CD70 molecule
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011202    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001252.2-738s1c1
Sequence:CCGGGCTGCTGATTAGGGTTTTTTACTCGAGTAAAAAACCCTAATCAGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001252.2-444s1c1
Sequence:CCGGCCATCGTGATGGCATCTACATCTCGAGATGTAGATGCCATCACGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001252.2-686s1c1
Sequence:CCGGGAAACACTGATGAGACCTTCTCTCGAGAGAAGGTCTCATCAGTGTTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001252.2-453s1c1
Sequence:CCGGTGGCATCTACATGGTACACATCTCGAGATGTGTACCATGTAGATGCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001252.2-319s1c1
Sequence:CCGGGTAGCTGAGCTGCAGCTGAATCTCGAGATTCAGCTGCAGCTCAGCTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001252.3-433s21c1
Sequence:CCGGCAGCTACGTATCCATCGTGATCTCGAGATCACGATGGATACGTAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001252.3-644s21c1
Sequence:CCGGACACACTCTGCACCAACCTCACTCGAGTGAGGTTGGTGCAGAGTGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001252
CD70 MISSION shRNA Lentiviral Transduction Particles
CD70 molecule
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011202    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001252.2-738s1c1
Sequence:CCGGGCTGCTGATTAGGGTTTTTTACTCGAGTAAAAAACCCTAATCAGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001252.2-444s1c1
Sequence:CCGGCCATCGTGATGGCATCTACATCTCGAGATGTAGATGCCATCACGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001252.2-686s1c1
Sequence:CCGGGAAACACTGATGAGACCTTCTCTCGAGAGAAGGTCTCATCAGTGTTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001252.2-453s1c1
Sequence:CCGGTGGCATCTACATGGTACACATCTCGAGATGTGTACCATGTAGATGCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001252.2-319s1c1
Sequence:CCGGGTAGCTGAGCTGCAGCTGAATCTCGAGATTCAGCTGCAGCTCAGCTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001252.3-433s21c1
Sequence:CCGGCAGCTACGTATCCATCGTGATCTCGAGATCACGATGGATACGTAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001252.3-644s21c1
Sequence:CCGGACACACTCTGCACCAACCTCACTCGAGTGAGGTTGGTGCAGAGTGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011617
CD70 MISSION shRNA Bacterial Glycerol Stock
CD70 molecule
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011617.1-465s1c1
Sequence:CCGGCATCTGCGTATCCATCAAGATCTCGAGATCTTGATGGATACGCAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011617.1-258s1c1
Sequence:CCGGGTGGTGTTTATTACTGTGTTTCTCGAGAAACACAGTAATAAACACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011617.1-351s1c1
Sequence:CCGGACAGCTGAGTTACAGCTGAATCTCGAGATTCAGCTGTAACTCAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011617.1-285s1c1
Sequence:CCGGTGGTTTCATTGTAGCGGACTACTCGAGTAGTCCGCTACAATGAAACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011617.1-626s1c1
Sequence:CCGGACAGGACTGTACAGTGGCATTCTCGAGAATGCCACTGTACAGTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011617
CD70 MISSION shRNA shRNA Plasmid DNA
CD70 molecule
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011617.1-465s1c1
Sequence:CCGGCATCTGCGTATCCATCAAGATCTCGAGATCTTGATGGATACGCAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011617.1-258s1c1
Sequence:CCGGGTGGTGTTTATTACTGTGTTTCTCGAGAAACACAGTAATAAACACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011617.1-351s1c1
Sequence:CCGGACAGCTGAGTTACAGCTGAATCTCGAGATTCAGCTGTAACTCAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011617.1-285s1c1
Sequence:CCGGTGGTTTCATTGTAGCGGACTACTCGAGTAGTCCGCTACAATGAAACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011617.1-626s1c1
Sequence:CCGGACAGGACTGTACAGTGGCATTCTCGAGAATGCCACTGTACAGTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011617
CD70 MISSION shRNA Lentiviral Transduction Particles
CD70 molecule
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011617.1-465s1c1
Sequence:CCGGCATCTGCGTATCCATCAAGATCTCGAGATCTTGATGGATACGCAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011617.1-258s1c1
Sequence:CCGGGTGGTGTTTATTACTGTGTTTCTCGAGAAACACAGTAATAAACACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011617.1-351s1c1
Sequence:CCGGACAGCTGAGTTACAGCTGAATCTCGAGATTCAGCTGTAACTCAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011617.1-285s1c1
Sequence:CCGGTGGTTTCATTGTAGCGGACTACTCGAGTAGTCCGCTACAATGAAACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011617.1-626s1c1
Sequence:CCGGACAGGACTGTACAGTGGCATTCTCGAGAATGCCACTGTACAGTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)