EMAIL THIS PAGE TO A FRIEND

CD7

CD7 molecule

58 Gene Product Result for
Synonyms: GP40 LEU-9 TP41 Tp40
UniProtKB ID: P09564
Gene ID:
Human(924) Summary: This gene encodes a transmembrane protein which is a member of the immunoglobulin superfamily. This protein is found on thymocytes and mature T cells. It plays an essential role in T-cell interactions and also in T-cell/B-cell interaction during early lymphoid development. [provided by RefSeq, Jul 2008]
Mouse(12516) CD7 antigen
Rat(303747) Cd7 molecule
sheep(101111110) CD7 molecule
chicken(417346) CD7 molecule
dog(607675) CD7 molecule
cow(510073) CD7 molecule
domestic cat(493848) CD7 molecule
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2502013 Anti-CD7 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB1405576 Anti-CD7 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA039079 Anti-CD7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1401056 Anti-CD7 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB5500071 Anti-CD7 antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP94, affinity isolated antibody human (tested)
immunohistochemistry pricing
WH0000924M4 Monoclonal Anti-CD7 antibody produced in mouse clone 1B8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation (IP), western blot pricing
SAB4700079 Monoclonal Anti-CD7 antibody produced in mouse clone MEM-186, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700080 Monoclonal Anti-CD7-APC antibody produced in mouse clone MEM-186, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700082 Monoclonal Anti-CD7-FITC antibody produced in mouse clone MEM-186, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700083 Monoclonal Anti-CD7-PE antibody produced in mouse clone MEM-186, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing

ELISA

Product # Description Species Add to Cart
 
RAB1350 Human CD7 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006137 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006137 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006137 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009854 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009854 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009854 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU156361 MISSION® esiRNA esiRNA human CD7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006137 Rosetta Predictions human pricing
NM_001107074 Rosetta Predictions rat pricing
NM_009854 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006137 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340968 predicted 446
2 SASI_Hs01_00092127 predicted 330
3 SASI_Hs02_00340969 predicted 378
4 SASI_Hs01_00092128 predicted 486
5 SASI_Hs01_00092129 predicted 258
6 SASI_Hs01_00092130 predicted 223
7 SASI_Hs01_00092131 predicted 507
8 SASI_Hs01_00092132 predicted 442
9 SASI_Hs01_00092133 predicted 226
10 SASI_Hs01_00092134 predicted 486
11 SASI_Hs01_00092135 predicted 430
12 SASI_Hs01_00092136 predicted 446
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107074 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225236 predicted 247
2 SASI_Rn02_00225237 predicted 203
3 SASI_Rn02_00225238 predicted 699
4 SASI_Rn02_00225239 predicted 466
5 SASI_Rn02_00225240 predicted 468
6 SASI_Rn02_00225241 predicted 277
7 SASI_Rn02_00225242 predicted 317
8 SASI_Rn02_00225243 predicted 254
9 SASI_Rn02_00225244 predicted 355
10 SASI_Rn02_00225245 predicted 399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009854 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028552 predicted 287
2 SASI_Mm01_00028553 predicted 710
3 SASI_Mm01_00028554 predicted 601
4 SASI_Mm01_00028555 predicted 416
5 SASI_Mm01_00028556 predicted 284
6 SASI_Mm01_00028557 predicted 587
7 SASI_Mm01_00028558 predicted 321
8 SASI_Mm01_00028559 predicted 236
9 SASI_Mm01_00028560 predicted 239
10 SASI_Mm01_00028561 predicted 702
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006137
CD7 MISSION shRNA Bacterial Glycerol Stock
CD7 molecule
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006137.6-513s21c1
Sequence:CCGGAGTCCCAAGGATGGCACAGATCTCGAGATCTGTGCCATCCTTGGGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006137.6-704s21c1
Sequence:CCGGGTGCTGGCGAGGACACAGATACTCGAGTATCTGTGTCCTCGCCAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006137.6-771s21c1
Sequence:CCGGTGTACGAGGACATGTCGCACACTCGAGTGTGCGACATGTCCTCGTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006137.5-279s1c1
Sequence:CCGGCCAAGACATCATTTACTACGACTCGAGTCGTAGTAAATGATGTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006137.5-434s1c1
Sequence:CCGGCGGAGGTCAATGTCTACGGCTCTCGAGAGCCGTAGACATTGACCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006137.5-206s1c1
Sequence:CCGGCCTCCGTCAACATCACCTGCTCTCGAGAGCAGGTGATGTTGACGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006137.5-366s1c1
Sequence:CCGGCAACCTGACTATCACCATGCACTCGAGTGCATGGTGATAGTCAGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006137.5-689s1c1
Sequence:CCGGCACAGATAAAGAAACTGTGCTCTCGAGAGCACAGTTTCTTTATCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006137
CD7 MISSION shRNA shRNA Plasmid DNA
CD7 molecule
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006137.6-513s21c1
Sequence:CCGGAGTCCCAAGGATGGCACAGATCTCGAGATCTGTGCCATCCTTGGGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006137.6-704s21c1
Sequence:CCGGGTGCTGGCGAGGACACAGATACTCGAGTATCTGTGTCCTCGCCAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000443262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006137.6-771s21c1
Sequence:CCGGTGTACGAGGACATGTCGCACACTCGAGTGTGCGACATGTCCTCGTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006137.5-279s1c1
Sequence:CCGGCCAAGACATCATTTACTACGACTCGAGTCGTAGTAAATGATGTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006137.5-434s1c1
Sequence:CCGGCGGAGGTCAATGTCTACGGCTCTCGAGAGCCGTAGACATTGACCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006137.5-206s1c1
Sequence:CCGGCCTCCGTCAACATCACCTGCTCTCGAGAGCAGGTGATGTTGACGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006137.5-366s1c1
Sequence:CCGGCAACCTGACTATCACCATGCACTCGAGTGCATGGTGATAGTCAGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006137.5-689s1c1
Sequence:CCGGCACAGATAAAGAAACTGTGCTCTCGAGAGCACAGTTTCTTTATCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006137
CD7 MISSION shRNA Lentiviral Transduction Particles
CD7 molecule
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006137.6-513s21c1
Sequence:CCGGAGTCCCAAGGATGGCACAGATCTCGAGATCTGTGCCATCCTTGGGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006137.6-704s21c1
Sequence:CCGGGTGCTGGCGAGGACACAGATACTCGAGTATCTGTGTCCTCGCCAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006137.6-771s21c1
Sequence:CCGGTGTACGAGGACATGTCGCACACTCGAGTGTGCGACATGTCCTCGTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006137.5-279s1c1
Sequence:CCGGCCAAGACATCATTTACTACGACTCGAGTCGTAGTAAATGATGTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006137.5-434s1c1
Sequence:CCGGCGGAGGTCAATGTCTACGGCTCTCGAGAGCCGTAGACATTGACCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006137.5-206s1c1
Sequence:CCGGCCTCCGTCAACATCACCTGCTCTCGAGAGCAGGTGATGTTGACGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006137.5-366s1c1
Sequence:CCGGCAACCTGACTATCACCATGCACTCGAGTGCATGGTGATAGTCAGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006137.5-689s1c1
Sequence:CCGGCACAGATAAAGAAACTGTGCTCTCGAGAGCACAGTTTCTTTATCTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009854
CD7 MISSION shRNA Bacterial Glycerol Stock
CD7 molecule
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009854.1-234s1c1
Sequence:CCGGCCTCAGGCTTACAATGTGATTCTCGAGAATCACATTGTAAGCCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009854.1-563s1c1
Sequence:CCGGGCTGAGGAAGATACAGATCAACTCGAGTTGATCTGTATCTTCCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009854.1-424s1c1
Sequence:CCGGCCACGGTTGTGGTGAAAGAAACTCGAGTTTCTTTCACCACAACCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009854.1-617s1c1
Sequence:CCGGGTGCGTAGTGTATGAAGACATCTCGAGATGTCTTCATACACTACGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009854.1-301s1c1
Sequence:CCGGGCCGAATTAATTTCTCTGGTTCTCGAGAACCAGAGAAATTAATTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009854
CD7 MISSION shRNA shRNA Plasmid DNA
CD7 molecule
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009854.1-234s1c1
Sequence:CCGGCCTCAGGCTTACAATGTGATTCTCGAGAATCACATTGTAAGCCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009854.1-563s1c1
Sequence:CCGGGCTGAGGAAGATACAGATCAACTCGAGTTGATCTGTATCTTCCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009854.1-424s1c1
Sequence:CCGGCCACGGTTGTGGTGAAAGAAACTCGAGTTTCTTTCACCACAACCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009854.1-617s1c1
Sequence:CCGGGTGCGTAGTGTATGAAGACATCTCGAGATGTCTTCATACACTACGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009854.1-301s1c1
Sequence:CCGGGCCGAATTAATTTCTCTGGTTCTCGAGAACCAGAGAAATTAATTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009854
CD7 MISSION shRNA Lentiviral Transduction Particles
CD7 molecule
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009854.1-234s1c1
Sequence:CCGGCCTCAGGCTTACAATGTGATTCTCGAGAATCACATTGTAAGCCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009854.1-563s1c1
Sequence:CCGGGCTGAGGAAGATACAGATCAACTCGAGTTGATCTGTATCTTCCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009854.1-424s1c1
Sequence:CCGGCCACGGTTGTGGTGAAAGAAACTCGAGTTTCTTTCACCACAACCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009854.1-617s1c1
Sequence:CCGGGTGCGTAGTGTATGAAGACATCTCGAGATGTCTTCATACACTACGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009854.1-301s1c1
Sequence:CCGGGCCGAATTAATTTCTCTGGTTCTCGAGAACCAGAGAAATTAATTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)