EMAIL THIS PAGE TO A FRIEND

CDC20B

cell division cycle 20B

52 Gene Product Result for
Gene ID:
Mouse(238896) cell division cycle 20B
chicken(426169) cell division cycle 20 homolog B (S. cerevisiae)
domestic cat(101095396) cell division cycle 20 homolog B (S. cerevisiae)
cow(522049) cell division cycle 20 homolog B (S. cerevisiae)
Horse(100062460) cell division cycle 20 homolog B (S. cerevisiae)
dog(478058) cell division cycle 20 homolog B (S. cerevisiae)
sheep(101116347) cell division cycle 20 homolog B (S. cerevisiae)
domestic guinea pig(100726479) cell division cycle 20B
naked mole-rat(101706366) cell division cycle 20B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152623 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152623 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152623 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_138861 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_138861 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_138861 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152623 Rosetta Predictions human pricing
XM_001473553 Rosetta Predictions mouse pricing
XM_138861 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152623 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238495 predicted 1293
2 SASI_Hs01_00238496 predicted 1176
3 SASI_Hs01_00238497 predicted 859
4 SASI_Hs01_00238498 predicted 572
5 SASI_Hs01_00238499 predicted 738
6 SASI_Hs01_00238500 predicted 1206
7 SASI_Hs01_00238501 predicted 312
8 SASI_Hs01_00238502 predicted 798
9 SASI_Hs01_00238503 predicted 1351
10 SASI_Hs01_00238504 predicted 857
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001473553 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00368938 predicted 1037
2 SASI_Mm02_00368939 predicted 239
3 SASI_Mm02_00368940 predicted 941
4 SASI_Mm02_00368941 predicted 731
5 SASI_Mm02_00368942 predicted 1183
6 SASI_Mm02_00368943 predicted 292
7 SASI_Mm02_00368944 predicted 955
8 SASI_Mm02_00368945 predicted 827
9 SASI_Mm02_00368946 predicted 961
10 SASI_Mm02_00368947 predicted 1028
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_138861 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00221428 predicted 1029
2 SASI_Mm02_00424838 predicted 241
3 SASI_Mm01_00221429 predicted 945
4 SASI_Mm02_00424839 predicted 727
5 SASI_Mm01_00221430 predicted 484
6 SASI_Mm01_00221431 predicted 1187
7 SASI_Mm01_00221432 predicted 296
8 SASI_Mm01_00221433 predicted 953
9 SASI_Mm01_00221435 predicted 824
10 SASI_Mm01_00221436 predicted 757
11 SASI_Mm01_00221434 predicted 214
12 SASI_Mm01_00221437 predicted 956
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152623
CDC20B MISSION shRNA Bacterial Glycerol Stock
cell division cycle 20B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152623.1-296s1c1
Sequence:CCGGGCCAACGTACTCGATTCAGTTCTCGAGAACTGAATCGAGTACGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152623.1-1094s1c1
Sequence:CCGGCGGCTGAGAAATATGCTTGGTCTCGAGACCAAGCATATTTCTCAGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152623.1-734s1c1
Sequence:CCGGCAATCCGAATGTGTTTGGAAACTCGAGTTTCCAAACACATTCGGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152623.1-1180s1c1
Sequence:CCGGGCGTGTTTATCATCACGATGTCTCGAGACATCGTGATGATAAACACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152623.1-733s1c1
Sequence:CCGGGCAATCCGAATGTGTTTGGAACTCGAGTTCCAAACACATTCGGATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155319    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152623.1-1299s1c1
Sequence:CCGGGTGATGGACTGCTGACAATATCTCGAGATATTGTCAGCAGTCCATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152623.1-950s1c1
Sequence:CCGGGAGAACCACAATGGGATTGAACTCGAGTTCAATCCCATTGTGGTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152623.2-1072s21c1
Sequence:CCGGTTATGGGATGTGGTAACTAAACTCGAGTTTAGTTACCACATCCCATAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152623.2-320s21c1
Sequence:CCGGATGCTACGTATTCTGACTTTACTCGAGTAAAGTCAGAATACGTAGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152623
CDC20B MISSION shRNA shRNA Plasmid DNA
cell division cycle 20B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152623.1-296s1c1
Sequence:CCGGGCCAACGTACTCGATTCAGTTCTCGAGAACTGAATCGAGTACGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152623.1-1094s1c1
Sequence:CCGGCGGCTGAGAAATATGCTTGGTCTCGAGACCAAGCATATTTCTCAGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152623.1-734s1c1
Sequence:CCGGCAATCCGAATGTGTTTGGAAACTCGAGTTTCCAAACACATTCGGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152623.1-1180s1c1
Sequence:CCGGGCGTGTTTATCATCACGATGTCTCGAGACATCGTGATGATAAACACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152623.1-733s1c1
Sequence:CCGGGCAATCCGAATGTGTTTGGAACTCGAGTTCCAAACACATTCGGATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155319    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152623.1-1299s1c1
Sequence:CCGGGTGATGGACTGCTGACAATATCTCGAGATATTGTCAGCAGTCCATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152623.1-950s1c1
Sequence:CCGGGAGAACCACAATGGGATTGAACTCGAGTTCAATCCCATTGTGGTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152623.2-1072s21c1
Sequence:CCGGTTATGGGATGTGGTAACTAAACTCGAGTTTAGTTACCACATCCCATAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152623.2-320s21c1
Sequence:CCGGATGCTACGTATTCTGACTTTACTCGAGTAAAGTCAGAATACGTAGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152623
CDC20B MISSION shRNA Lentiviral Transduction Particles
cell division cycle 20B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152623.1-296s1c1
Sequence:CCGGGCCAACGTACTCGATTCAGTTCTCGAGAACTGAATCGAGTACGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152623.1-1094s1c1
Sequence:CCGGCGGCTGAGAAATATGCTTGGTCTCGAGACCAAGCATATTTCTCAGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152623.1-734s1c1
Sequence:CCGGCAATCCGAATGTGTTTGGAAACTCGAGTTTCCAAACACATTCGGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152623.1-1180s1c1
Sequence:CCGGGCGTGTTTATCATCACGATGTCTCGAGACATCGTGATGATAAACACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152623.1-733s1c1
Sequence:CCGGGCAATCCGAATGTGTTTGGAACTCGAGTTCCAAACACATTCGGATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155319    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152623.1-1299s1c1
Sequence:CCGGGTGATGGACTGCTGACAATATCTCGAGATATTGTCAGCAGTCCATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152623.1-950s1c1
Sequence:CCGGGAGAACCACAATGGGATTGAACTCGAGTTCAATCCCATTGTGGTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152623.2-1072s21c1
Sequence:CCGGTTATGGGATGTGGTAACTAAACTCGAGTTTAGTTACCACATCCCATAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152623.2-320s21c1
Sequence:CCGGATGCTACGTATTCTGACTTTACTCGAGTAAAGTCAGAATACGTAGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_138861
CDC20B MISSION shRNA Bacterial Glycerol Stock
cell division cycle 20B
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000088276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138861.3-102s1c1
Sequence:CCGGTGCTGGTGAAGGTCAACATTTCTCGAGAAATGTTGACCTTCACCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138861.3-489s1c1
Sequence:CCGGCCTAACTCTACGATCCCACAACTCGAGTTGTGGGATCGTAGAGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138861.3-1256s1c1
Sequence:CCGGCCAGTGGGTGTAATGATGGATCTCGAGATCCATCATTACACCCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138861.3-1182s1c1
Sequence:CCGGGCATCGTGTTGGAACACTTTACTCGAGTAAAGTGTTCCAACACGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_138861
CDC20B MISSION shRNA shRNA Plasmid DNA
cell division cycle 20B
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000088276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138861.3-102s1c1
Sequence:CCGGTGCTGGTGAAGGTCAACATTTCTCGAGAAATGTTGACCTTCACCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138861.3-489s1c1
Sequence:CCGGCCTAACTCTACGATCCCACAACTCGAGTTGTGGGATCGTAGAGTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138861.3-1256s1c1
Sequence:CCGGCCAGTGGGTGTAATGATGGATCTCGAGATCCATCATTACACCCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138861.3-1182s1c1
Sequence:CCGGGCATCGTGTTGGAACACTTTACTCGAGTAAAGTGTTCCAACACGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_138861
CDC20B MISSION shRNA Lentiviral Transduction Particles
cell division cycle 20B
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000088276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138861.3-102s1c1
Sequence:CCGGTGCTGGTGAAGGTCAACATTTCTCGAGAAATGTTGACCTTCACCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138861.3-489s1c1
Sequence:CCGGCCTAACTCTACGATCCCACAACTCGAGTTGTGGGATCGTAGAGTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138861.3-1256s1c1
Sequence:CCGGCCAGTGGGTGTAATGATGGATCTCGAGATCCATCATTACACCCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138861.3-1182s1c1
Sequence:CCGGGCATCGTGTTGGAACACTTTACTCGAGTAAAGTGTTCCAACACGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)