EMAIL THIS PAGE TO A FRIEND

CDC42EP2

CDC42 effector protein (Rho GTPase binding) 2

52 Gene Product Result for
Synonyms: BORG1 CEP2
UniProtKB ID: O14613, B2RD85, Q9UNS0
Gene ID:
Human(10435) Summary: CDC42, a small Rho GTPase, regulates the formation of F-actin-containing structures through its interaction with the downstream effector proteins. The protein encoded by this gene is a member of the Borg family of CDC42 effector proteins. Borg family proteins contain a CRIB (Cdc42/Rac interactive-binding) domain. They bind to, and negatively regulate the function of CDC42. Coexpression of this protein with CDC42 suggested a role of this protein in actin filament assembly and cell shape control. [provided by RefSeq, Aug 2011]
Mouse(104252) CDC42 effector protein (Rho GTPase binding) 2
Rat(309175) CDC42 effector protein (Rho GTPase binding) 2
Zebrafish(541404) CDC42 effector protein (Rho GTPase binding) 2
cow(507966) CDC42 effector protein (Rho GTPase binding) 2
domestic cat(101085072) CDC42 effector protein (Rho GTPase binding) 2
dog(483744) CDC42 effector protein (Rho GTPase binding) 2
chicken(426985) CDC42 effector protein (Rho GTPase binding) 2
naked mole-rat(101725423) CDC42 effector protein (Rho GTPase binding) 2
domestic guinea pig(100727580) CDC42 effector protein (Rho GTPase binding) 2
sheep(101122234) CDC42 effector protein (Rho GTPase binding) 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026772 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026772 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026772 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006779 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006779 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006779 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006779 Rosetta Predictions human pricing
NM_001009689 Rosetta Predictions rat pricing
NM_026772 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006779 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105157 predicted 1282
2 SASI_Hs02_00342292 predicted 1172
3 SASI_Hs01_00105159 predicted 447
4 SASI_Hs02_00342293 predicted 760
5 SASI_Hs01_00105161 predicted 450
6 SASI_Hs01_00105162 predicted 585
7 SASI_Hs01_00105163 predicted 555
8 SASI_Hs01_00105164 predicted 1504
9 SASI_Hs01_00105165 predicted 752
10 SASI_Hs01_00105166 predicted 1265
11 SASI_Hs01_00105158 predicted 1171
12 SASI_Hs01_00105160 predicted 765
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009689 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109730 predicted 549
2 SASI_Rn02_00199749 predicted 1102
3 SASI_Rn01_00109731 predicted 909
4 SASI_Rn01_00109732 predicted 818
5 SASI_Rn01_00109733 predicted 934
6 SASI_Rn01_00109734 predicted 1090
7 SASI_Rn01_00109736 predicted 1028
8 SASI_Rn01_00109737 predicted 572
9 SASI_Rn01_00109738 predicted 592
10 SASI_Rn01_00109739 predicted 1073
11 SASI_Rn01_00109735 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026772 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187209 predicted 953
2 SASI_Mm01_00187211 predicted 555
3 SASI_Mm01_00187212 predicted 1170
4 SASI_Mm01_00187214 predicted 646
5 SASI_Mm01_00187215 predicted 1003
6 SASI_Mm01_00187216 predicted 1212
7 SASI_Mm02_00330836 predicted 550
8 SASI_Mm01_00187217 predicted 1057
9 SASI_Mm02_00330837 predicted 1031
10 SASI_Mm02_00330838 predicted 1170
11 SASI_Mm01_00187208 predicted 1198
12 SASI_Mm01_00187210 predicted 918
13 SASI_Mm01_00187213 predicted 452
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026772
CDC42EP2 MISSION shRNA Bacterial Glycerol Stock
CDC42 effector protein (Rho GTPase binding) 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026772.1-954s21c1
Sequence:CCGGCGCGTGCAGATTCCTACATAACTCGAGTTATGTAGGAATCTGCACGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026772.1-1294s21c1
Sequence:CCGGTTGTTGGTATCGTTGGCTATGCTCGAGCATAGCCAACGATACCAACAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026772.1-466s21c1
Sequence:CCGGGTGGCGGAGATGACATGTTTGCTCGAGCAAACATGTCATCTCCGCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026772.1-578s21c1
Sequence:CCGGCCAGTTTACTCGCACTACAACCTCGAGGTTGTAGTGCGAGTAAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198825    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026772.1-563s1c1
Sequence:CCGGCTTTGACCTTCCCTTCCAGTTCTCGAGAACTGGAAGGGAAGGTCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026772.1-368s1c1
Sequence:CCGGCCGCAAAGGCAAGAAAGAGAACTCGAGTTCTCTTTCTTGCCTTTGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026772.1-371s1c1
Sequence:CCGGCAAAGGCAAGAAAGAGAAGCTCTCGAGAGCTTCTCTTTCTTGCCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026772.1-437s1c1
Sequence:CCGGCTTCCGTCACACTATTCACATCTCGAGATGTGAATAGTGTGACGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026772.1-929s1c1
Sequence:CCGGCCAGATTATGGATCACGACCTCTCGAGAGGTCGTGATCCATAATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026772
CDC42EP2 MISSION shRNA shRNA Plasmid DNA
CDC42 effector protein (Rho GTPase binding) 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026772.1-954s21c1
Sequence:CCGGCGCGTGCAGATTCCTACATAACTCGAGTTATGTAGGAATCTGCACGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026772.1-1294s21c1
Sequence:CCGGTTGTTGGTATCGTTGGCTATGCTCGAGCATAGCCAACGATACCAACAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026772.1-466s21c1
Sequence:CCGGGTGGCGGAGATGACATGTTTGCTCGAGCAAACATGTCATCTCCGCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026772.1-578s21c1
Sequence:CCGGCCAGTTTACTCGCACTACAACCTCGAGGTTGTAGTGCGAGTAAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198825    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026772.1-563s1c1
Sequence:CCGGCTTTGACCTTCCCTTCCAGTTCTCGAGAACTGGAAGGGAAGGTCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026772.1-368s1c1
Sequence:CCGGCCGCAAAGGCAAGAAAGAGAACTCGAGTTCTCTTTCTTGCCTTTGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026772.1-371s1c1
Sequence:CCGGCAAAGGCAAGAAAGAGAAGCTCTCGAGAGCTTCTCTTTCTTGCCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026772.1-437s1c1
Sequence:CCGGCTTCCGTCACACTATTCACATCTCGAGATGTGAATAGTGTGACGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026772.1-929s1c1
Sequence:CCGGCCAGATTATGGATCACGACCTCTCGAGAGGTCGTGATCCATAATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026772
CDC42EP2 MISSION shRNA Lentiviral Transduction Particles
CDC42 effector protein (Rho GTPase binding) 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026772.1-954s21c1
Sequence:CCGGCGCGTGCAGATTCCTACATAACTCGAGTTATGTAGGAATCTGCACGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026772.1-1294s21c1
Sequence:CCGGTTGTTGGTATCGTTGGCTATGCTCGAGCATAGCCAACGATACCAACAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026772.1-466s21c1
Sequence:CCGGGTGGCGGAGATGACATGTTTGCTCGAGCAAACATGTCATCTCCGCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026772.1-578s21c1
Sequence:CCGGCCAGTTTACTCGCACTACAACCTCGAGGTTGTAGTGCGAGTAAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198825    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026772.1-563s1c1
Sequence:CCGGCTTTGACCTTCCCTTCCAGTTCTCGAGAACTGGAAGGGAAGGTCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026772.1-368s1c1
Sequence:CCGGCCGCAAAGGCAAGAAAGAGAACTCGAGTTCTCTTTCTTGCCTTTGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026772.1-371s1c1
Sequence:CCGGCAAAGGCAAGAAAGAGAAGCTCTCGAGAGCTTCTCTTTCTTGCCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026772.1-437s1c1
Sequence:CCGGCTTCCGTCACACTATTCACATCTCGAGATGTGAATAGTGTGACGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026772.1-929s1c1
Sequence:CCGGCCAGATTATGGATCACGACCTCTCGAGAGGTCGTGATCCATAATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006779
CDC42EP2 MISSION shRNA Bacterial Glycerol Stock
CDC42 effector protein (Rho GTPase binding) 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006779.2-483s21c1
Sequence:CCGGTGGCAGTCGCAAGGGCAAGAACTCGAGTTCTTGCCCTTGCGACTGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426849    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006779.2-1342s21c1
Sequence:CCGGCCCATCACAATACTCCTTCTTCTCGAGAAGAAGGAGTATTGTGATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006779.2-594s1c1
Sequence:CCGGCAGTGACATGTTTGGCGACATCTCGAGATGTCGCCAAACATGTCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006779.2-565s1c1
Sequence:CCGGCACACCATTCATATTGGCAGTCTCGAGACTGCCAATATGAATGGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006779.2-1035s1c1
Sequence:CCGGCCTGCAGATCATGGATCAGGACTCGAGTCCTGATCCATGATCTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006779.2-753s1c1
Sequence:CCGGCCCTCTGCTCAAGAACGCCATCTCGAGATGGCGTTCTTGAGCAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006779.2-519s1c1
Sequence:CCGGCCTGCTGTCCTCGGACATGATCTCGAGATCATGTCCGAGGACAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006779
CDC42EP2 MISSION shRNA shRNA Plasmid DNA
CDC42 effector protein (Rho GTPase binding) 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006779.2-483s21c1
Sequence:CCGGTGGCAGTCGCAAGGGCAAGAACTCGAGTTCTTGCCCTTGCGACTGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426849    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006779.2-1342s21c1
Sequence:CCGGCCCATCACAATACTCCTTCTTCTCGAGAAGAAGGAGTATTGTGATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006779.2-594s1c1
Sequence:CCGGCAGTGACATGTTTGGCGACATCTCGAGATGTCGCCAAACATGTCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006779.2-565s1c1
Sequence:CCGGCACACCATTCATATTGGCAGTCTCGAGACTGCCAATATGAATGGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006779.2-1035s1c1
Sequence:CCGGCCTGCAGATCATGGATCAGGACTCGAGTCCTGATCCATGATCTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006779.2-753s1c1
Sequence:CCGGCCCTCTGCTCAAGAACGCCATCTCGAGATGGCGTTCTTGAGCAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006779.2-519s1c1
Sequence:CCGGCCTGCTGTCCTCGGACATGATCTCGAGATCATGTCCGAGGACAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006779
CDC42EP2 MISSION shRNA Lentiviral Transduction Particles
CDC42 effector protein (Rho GTPase binding) 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006779.2-483s21c1
Sequence:CCGGTGGCAGTCGCAAGGGCAAGAACTCGAGTTCTTGCCCTTGCGACTGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426849    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006779.2-1342s21c1
Sequence:CCGGCCCATCACAATACTCCTTCTTCTCGAGAAGAAGGAGTATTGTGATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006779.2-594s1c1
Sequence:CCGGCAGTGACATGTTTGGCGACATCTCGAGATGTCGCCAAACATGTCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006779.2-565s1c1
Sequence:CCGGCACACCATTCATATTGGCAGTCTCGAGACTGCCAATATGAATGGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006779.2-1035s1c1
Sequence:CCGGCCTGCAGATCATGGATCAGGACTCGAGTCCTGATCCATGATCTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006779.2-753s1c1
Sequence:CCGGCCCTCTGCTCAAGAACGCCATCTCGAGATGGCGTTCTTGAGCAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006779.2-519s1c1
Sequence:CCGGCCTGCTGTCCTCGGACATGATCTCGAGATCATGTCCGAGGACAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)