EMAIL THIS PAGE TO A FRIEND

CDK16

cyclin-dependent kinase 16

170 Gene Product Result for
Synonyms: PCTAIRE PCTAIRE1 PCTGAIRE PCTK1
UniProtKB ID: Q00536, A8K280, B7Z7C8, J3KN74, J3KQP7
Gene ID:
Human(5127) Summary: The protein encoded by this gene belongs to the cdc2/cdkx subfamily of the ser/thr family of protein kinases. It may play a role in signal transduction cascades in terminally differentiated cells; in exocytosis; and in transport of secretory cargo from the endoplasmic reticulum. This gene is thought to escape X inactivation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2009]
Mouse(18555) cyclin-dependent kinase 16
Rat(81741) cyclin-dependent kinase 16
Zebrafish(559750) cyclin-dependent kinase 16
cow(613810) cyclin-dependent kinase 16
Horse(100060831) cyclin-dependent kinase 16
domestic cat(101094653) cyclin-dependent kinase 16
dog(480897) cyclin-dependent kinase 16
domestic guinea pig(100726612) cyclin-dependent kinase 16
naked mole-rat(101718917) cyclin-dependent kinase 16
sheep(101116802) cyclin-dependent kinase 16
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033018 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033018 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033018 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011049 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011049 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011049 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006201 Rosetta Predictions human pricing
NM_033018 Rosetta Predictions human pricing
NM_001004132 Rosetta Predictions rat pricing
NM_031077 Rosetta Predictions rat pricing
NM_011049 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006201 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197967 predicted 950
2 SASI_Hs01_00197968 predicted 592
3 SASI_Hs01_00197969 predicted 1753
4 SASI_Hs01_00197970 predicted 1056
5 SASI_Hs01_00197971 predicted 908
6 SASI_Hs01_00197972 predicted 1333
7 SASI_Hs01_00197973 predicted 1159
8 SASI_Hs01_00197974 predicted 1676
9 SASI_Hs01_00197975 predicted 726
10 SASI_Hs01_00197976 predicted 1714
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033018 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245722 predicted 991
2 SASI_Hs01_00245723 predicted 637
3 SASI_Hs01_00245724 predicted 1792
4 SASI_Hs01_00245725 predicted 1093
5 SASI_Hs01_00245726 predicted 950
6 SASI_Hs01_00245727 predicted 1369
7 SASI_Hs01_00245728 predicted 1195
8 SASI_Hs01_00245729 predicted 1710
9 SASI_Hs01_00245730 predicted 772
10 SASI_Hs01_00245731 predicted 1753
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004132 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083922 predicted 538
2 SASI_Rn01_00083923 predicted 683
3 SASI_Rn01_00083924 predicted 416
4 SASI_Rn01_00083925 predicted 1199
5 SASI_Rn01_00083926 predicted 1175
6 SASI_Rn01_00083927 predicted 1332
7 SASI_Rn01_00083928 predicted 1023
8 SASI_Rn01_00083929 predicted 686
9 SASI_Rn01_00083930 predicted 795
10 SASI_Rn01_00083931 predicted 1189
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031077 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095177 predicted 896
2 SASI_Rn01_00095178 predicted 1042
3 SASI_Rn01_00095179 predicted 1558
4 SASI_Rn01_00095180 predicted 1535
5 SASI_Rn01_00095181 predicted 1698
6 SASI_Rn01_00095182 predicted 699
7 SASI_Rn01_00095183 predicted 1390
8 SASI_Rn01_00095184 predicted 1272
9 SASI_Rn01_00095185 predicted 1049
10 SASI_Rn01_00095186 predicted 1148
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011049 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192012 predicted 1487
2 SASI_Mm01_00192013 predicted 1496
3 SASI_Mm01_00192014 predicted 975
4 SASI_Mm01_00192015 predicted 1470
5 SASI_Mm01_00192016 predicted 519
6 SASI_Mm01_00192017 predicted 683
7 SASI_Mm01_00192018 predicted 809
8 SASI_Mm01_00192019 predicted 1487
9 SASI_Mm01_00192020 predicted 770
10 SASI_Mm01_00192021 predicted 727
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033018
VALIDATED
CDK16 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 16
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033018.3-1031s21c1
Sequence:CCGGGACCTACATTAAGCTGGACAACTCGAGTTGTCCAGCTTAATGTAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033018.3-1718s21c1
Sequence:CCGGCGAGGAGTTCAAGACATACAACTCGAGTTGTATGTCTTGAACTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033018.3-1190s21c1
Sequence:CCGGGGACCTCAAACACGCCAACATCTCGAGATGTTGGCGTGTTTGAGGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033018.3-2239s21c1
Sequence:CCGGGCTCTCATCACTCCTTCACTTCTCGAGAAGTGAAGGAGTGATGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033018.x-1095s1c1
Sequence:CCGGGGACCTCAAACACGCCAACATCTCGAGATGTTGGCGTGTTTGAGGTCCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033018.x-1623s1c1
Sequence:CCGGCGAGGAGTTCAAGACATACAACTCGAGTTGTATGTCTTGAACTCCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033018.x-936s1c1
Sequence:CCGGGACCTACATTAAGCTGGACAACTCGAGTTGTCCAGCTTAATGTAGGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033018.x-502s1c1
Sequence:CCGGCGAGGCATAGACAAGACCAATCTCGAGATTGGTCTTGTCTATGCCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033018.x-1386s1c1
Sequence:CCGGCCCAACAAAGACATACTCCAACTCGAGTTGGAGTATGTCTTTGTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033018.2-896s1c1
Sequence:CCGGGCCTATCTGAGATTGGCTTTGCTCGAGCAAAGCCAATCTCAGATAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197222    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033018.2-2135s1c1
Sequence:CCGGGCTCTCATCACTCCTTCACTTCTCGAGAAGTGAAGGAGTGATGAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033018.2-1995s1c1
Sequence:CCGGCAACTACATCTTCCCTGCTTACTCGAGTAAGCAGGGAAGATGTAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033018.2-1549s1c1
Sequence:CCGGCTACACTTCATCTTCCGTATCCTCGAGGATACGGAAGATGAAGTGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033018.2-2473s1c1
Sequence:CCGGGCAATATCTCTGTATACAGACCTCGAGGTCTGTATACAGAGATATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033018
VALIDATED
CDK16 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 16
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033018.3-1031s21c1
Sequence:CCGGGACCTACATTAAGCTGGACAACTCGAGTTGTCCAGCTTAATGTAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033018.3-1718s21c1
Sequence:CCGGCGAGGAGTTCAAGACATACAACTCGAGTTGTATGTCTTGAACTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033018.3-1190s21c1
Sequence:CCGGGGACCTCAAACACGCCAACATCTCGAGATGTTGGCGTGTTTGAGGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033018.3-2239s21c1
Sequence:CCGGGCTCTCATCACTCCTTCACTTCTCGAGAAGTGAAGGAGTGATGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033018.x-1095s1c1
Sequence:CCGGGGACCTCAAACACGCCAACATCTCGAGATGTTGGCGTGTTTGAGGTCCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033018.x-1623s1c1
Sequence:CCGGCGAGGAGTTCAAGACATACAACTCGAGTTGTATGTCTTGAACTCCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033018.x-936s1c1
Sequence:CCGGGACCTACATTAAGCTGGACAACTCGAGTTGTCCAGCTTAATGTAGGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033018.x-502s1c1
Sequence:CCGGCGAGGCATAGACAAGACCAATCTCGAGATTGGTCTTGTCTATGCCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033018.x-1386s1c1
Sequence:CCGGCCCAACAAAGACATACTCCAACTCGAGTTGGAGTATGTCTTTGTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033018.2-896s1c1
Sequence:CCGGGCCTATCTGAGATTGGCTTTGCTCGAGCAAAGCCAATCTCAGATAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197222    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033018.2-2135s1c1
Sequence:CCGGGCTCTCATCACTCCTTCACTTCTCGAGAAGTGAAGGAGTGATGAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033018.2-1995s1c1
Sequence:CCGGCAACTACATCTTCCCTGCTTACTCGAGTAAGCAGGGAAGATGTAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033018.2-1549s1c1
Sequence:CCGGCTACACTTCATCTTCCGTATCCTCGAGGATACGGAAGATGAAGTGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033018.2-2473s1c1
Sequence:CCGGGCAATATCTCTGTATACAGACCTCGAGGTCTGTATACAGAGATATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033018
VALIDATED
CDK16 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 16
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033018.3-1031s21c1
Sequence:CCGGGACCTACATTAAGCTGGACAACTCGAGTTGTCCAGCTTAATGTAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033018.3-1718s21c1
Sequence:CCGGCGAGGAGTTCAAGACATACAACTCGAGTTGTATGTCTTGAACTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033018.3-1190s21c1
Sequence:CCGGGGACCTCAAACACGCCAACATCTCGAGATGTTGGCGTGTTTGAGGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033018.3-2239s21c1
Sequence:CCGGGCTCTCATCACTCCTTCACTTCTCGAGAAGTGAAGGAGTGATGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033018.x-1095s1c1
Sequence:CCGGGGACCTCAAACACGCCAACATCTCGAGATGTTGGCGTGTTTGAGGTCCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033018.x-1623s1c1
Sequence:CCGGCGAGGAGTTCAAGACATACAACTCGAGTTGTATGTCTTGAACTCCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033018.x-936s1c1
Sequence:CCGGGACCTACATTAAGCTGGACAACTCGAGTTGTCCAGCTTAATGTAGGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033018.x-502s1c1
Sequence:CCGGCGAGGCATAGACAAGACCAATCTCGAGATTGGTCTTGTCTATGCCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033018.x-1386s1c1
Sequence:CCGGCCCAACAAAGACATACTCCAACTCGAGTTGGAGTATGTCTTTGTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033018.2-896s1c1
Sequence:CCGGGCCTATCTGAGATTGGCTTTGCTCGAGCAAAGCCAATCTCAGATAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197222    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033018.2-2135s1c1
Sequence:CCGGGCTCTCATCACTCCTTCACTTCTCGAGAAGTGAAGGAGTGATGAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033018.2-1995s1c1
Sequence:CCGGCAACTACATCTTCCCTGCTTACTCGAGTAAGCAGGGAAGATGTAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033018.2-1549s1c1
Sequence:CCGGCTACACTTCATCTTCCGTATCCTCGAGGATACGGAAGATGAAGTGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033018.2-2473s1c1
Sequence:CCGGGCAATATCTCTGTATACAGACCTCGAGGTCTGTATACAGAGATATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011049
VALIDATED
CDK16 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 16
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011049.4-1710s21c1
Sequence:CCGGGCACTAAAGGAGGTACAGCTACTCGAGTAGCTGTACCTCCTTTAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011049.4-1248s21c1
Sequence:CCGGGCCAAGTCAATTCCTACTAAACTCGAGTTTAGTAGGAATTGACTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011049.4-981s21c1
Sequence:CCGGGCCAACATCGTCACACTACATCTCGAGATGTAGTGTGACGATGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011049.4-771s21c1
Sequence:CCGGCGAGTCAGTTTGTCTGAGATTCTCGAGAATCTCAGACAAACTGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011049.2-1249s1c1
Sequence:CCGGGCCAAGTCAATTCCTACTAAACTCGAGTTTAGTAGGAATTGACTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011049.2-1711s1c1
Sequence:CCGGGCACTAAAGGAGGTACAGCTACTCGAGTAGCTGTACCTCCTTTAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011049.2-982s1c1
Sequence:CCGGGCCAACATCGTCACACTACATCTCGAGATGTAGTGTGACGATGTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011049.2-376s1c1
Sequence:CCGGCGAGGCATAGATAAGACCAATCTCGAGATTGGTCTTATCTATGCCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011049.2-772s1c1
Sequence:CCGGCGAGTCAGTTTGTCTGAGATTCTCGAGAATCTCAGACAAACTGACTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011049
VALIDATED
CDK16 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 16
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011049.4-1710s21c1
Sequence:CCGGGCACTAAAGGAGGTACAGCTACTCGAGTAGCTGTACCTCCTTTAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011049.4-1248s21c1
Sequence:CCGGGCCAAGTCAATTCCTACTAAACTCGAGTTTAGTAGGAATTGACTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011049.4-981s21c1
Sequence:CCGGGCCAACATCGTCACACTACATCTCGAGATGTAGTGTGACGATGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011049.4-771s21c1
Sequence:CCGGCGAGTCAGTTTGTCTGAGATTCTCGAGAATCTCAGACAAACTGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011049.2-1249s1c1
Sequence:CCGGGCCAAGTCAATTCCTACTAAACTCGAGTTTAGTAGGAATTGACTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011049.2-1711s1c1
Sequence:CCGGGCACTAAAGGAGGTACAGCTACTCGAGTAGCTGTACCTCCTTTAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011049.2-982s1c1
Sequence:CCGGGCCAACATCGTCACACTACATCTCGAGATGTAGTGTGACGATGTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011049.2-376s1c1
Sequence:CCGGCGAGGCATAGATAAGACCAATCTCGAGATTGGTCTTATCTATGCCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011049.2-772s1c1
Sequence:CCGGCGAGTCAGTTTGTCTGAGATTCTCGAGAATCTCAGACAAACTGACTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011049
VALIDATED
CDK16 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 16
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011049.4-1710s21c1
Sequence:CCGGGCACTAAAGGAGGTACAGCTACTCGAGTAGCTGTACCTCCTTTAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011049.4-1248s21c1
Sequence:CCGGGCCAAGTCAATTCCTACTAAACTCGAGTTTAGTAGGAATTGACTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011049.4-981s21c1
Sequence:CCGGGCCAACATCGTCACACTACATCTCGAGATGTAGTGTGACGATGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011049.4-771s21c1
Sequence:CCGGCGAGTCAGTTTGTCTGAGATTCTCGAGAATCTCAGACAAACTGACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011049.2-1249s1c1
Sequence:CCGGGCCAAGTCAATTCCTACTAAACTCGAGTTTAGTAGGAATTGACTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011049.2-1711s1c1
Sequence:CCGGGCACTAAAGGAGGTACAGCTACTCGAGTAGCTGTACCTCCTTTAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011049.2-982s1c1
Sequence:CCGGGCCAACATCGTCACACTACATCTCGAGATGTAGTGTGACGATGTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011049.2-376s1c1
Sequence:CCGGCGAGGCATAGATAAGACCAATCTCGAGATTGGTCTTATCTATGCCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011049.2-772s1c1
Sequence:CCGGCGAGTCAGTTTGTCTGAGATTCTCGAGAATCTCAGACAAACTGACTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)