EMAIL THIS PAGE TO A FRIEND

CDK2

cyclin-dependent kinase 2

191 Gene Product Result for
Synonyms: p33(CDK2)
UniProtKB ID: P24941, A8K7C6, O75100
Gene ID:
Human(1017) Summary: The protein encoded by this gene is a member of the Ser/Thr protein kinase family. This protein kinase is highly similar to the gene products of S. cerevisiae cdc28, and S. pombe cdc2. It is a catalytic subunit of the cyclin-dependent protein kinase complex, whose activity is restricted to the G1-S phase, and essential for cell cycle G1/S phase transition. This protein associates with and regulated by the regulatory subunits of the complex including cyclin A or E, CDK inhibitor p21Cip1 (CDKN1A) and p27Kip1 (CDKN1B). Its activity is also regulated by its protein phosphorylation. Two alternatively spliced variants and multiple transcription initiation sites of this gene have been reported. [provided by RefSeq, Jul 2008]
Mouse(12566) cyclin-dependent kinase 2
Rat(362817) cyclin dependent kinase 2
Zebrafish(406715) cyclin-dependent kinase 2
cow(519217) cyclin-dependent kinase 2
chicken(100529062) cyclin-dependent kinase 2
dog(606931) cyclin-dependent kinase 2
domestic cat(101093368) cyclin-dependent kinase 2
domestic guinea pig(100714324) cyclin-dependent kinase 2
naked mole-rat(101725353) cyclin-dependent kinase 2
Goat(100860751) cyclin-dependent kinase 2
sheep(100216433) cyclin-dependent kinase 2
Domestic Rabbit(100134865) cyclin-dependent kinase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4500050 Anti-CDK1 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB4300388 Anti-CDK2 (Ab-160) antibody produced in rabbit affinity isolated antibody human, mouse, rat
western blot pricing
AV01008 Anti-CDK2 (AB1) antibody produced in rabbit IgG fraction of antiserum goat, human, bovine, rabbit, rat, zebrafish, mouse, guinea pig, sheep
western blot pricing
C5223 Anti-Cdk2 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous glycerol solution human, mouse (predicted), rat (predicted)
immunoprecipitation (IP), western blot pricing
HPA066915 Anti-CDK2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB4500052 Anti-CDK2 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, western blot pricing
AV03006 Anti-CDK2 antibody produced in rabbit IgG fraction of antiserum human, rat, bovine, sheep, mouse, rabbit, goat
immunohistochemistry, western blot pricing
SAB4504362 Anti-phospho-CDK2 (pThr160) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4300110 Anti-phospho-CDK2 (pThr160) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
AMAB91497 Monoclonal Anti-CDK2 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL7990, purified immunoglobulin, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry pricing
SAB5300328 Monoclonal Anti-CDK2 antibody produced in mouse clone 1A6, purified immunoglobulin, buffered aqueous solution human, mouse
ELISA, flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
PLA0213 Rabbit anti-CDK2 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. mouse, human
immunohistochemistry, immunoprecipitation (IP), western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052827 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052827 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052827 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001798 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001798 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001798 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016756 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016756 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016756 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001798 siRNAs that have been validated in the lab human pricing
NM_052827 siRNAs that have been validated in the lab human pricing
NM_199501 Rosetta Predictions rat pricing
NM_016756 Rosetta Predictions mouse pricing
NM_183417 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001798 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060175 validated 274 220.00
1 SASI_Hs01_00060174 validated 308 220.00
2 SASI_Hs01_00060176 predicted 347 154.00
3 SASI_Hs01_00060177 predicted 387 154.00
4 SASI_Hs01_00060178 predicted 293 154.00
5 SASI_Hs01_00060179 predicted 433 154.00
6 SASI_Hs01_00060180 predicted 653 154.00
7 SASI_Hs01_00060181 predicted 841 154.00
8 SASI_Hs01_00060183 predicted 406 154.00
9 SASI_Hs02_00332570 predicted 1126 154.00
10 SASI_Hs01_00060182 predicted 914 154.00
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052827 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023683 validated 316 220.00
2 SASI_Hs01_00023684 predicted 265 154.00
3 SASI_Hs01_00023685 predicted 354 154.00
4 SASI_Hs01_00023686 predicted 389 154.00
5 SASI_Hs01_00023687 predicted 300 154.00
6 SASI_Hs01_00023688 predicted 437 154.00
7 SASI_Hs01_00023689 predicted 646 154.00
8 SASI_Hs01_00023690 predicted 744 154.00
9 SASI_Hs01_00023692 predicted 399 154.00
10 SASI_Hs02_00361502 predicted 1017 154.00
11 SASI_Hs01_00023691 predicted 820 154.00
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199501 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068386 predicted 833 154.00
2 SASI_Rn01_00068387 predicted 226 154.00
3 SASI_Rn01_00068388 predicted 1419 154.00
4 SASI_Rn01_00068389 predicted 1483 154.00
5 SASI_Rn01_00068390 predicted 559 154.00
6 SASI_Rn01_00068391 predicted 1498 154.00
7 SASI_Rn01_00068392 predicted 291 154.00
8 SASI_Rn01_00068393 predicted 453 154.00
9 SASI_Rn01_00068394 predicted 1495 154.00
10 SASI_Rn01_00068395 predicted 848 154.00
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016756 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323492 predicted 1107 154.00
2 SASI_Mm01_00151932 predicted 1571 154.00
3 SASI_Mm01_00151933 predicted 1422 154.00
4 SASI_Mm02_00323493 predicted 1418 154.00
5 SASI_Mm02_00323494 predicted 587 154.00
6 SASI_Mm01_00151934 predicted 1351 154.00
7 SASI_Mm02_00323495 predicted 416 154.00
8 SASI_Mm01_00151935 predicted 522 154.00
9 SASI_Mm01_00151939 predicted 1418 154.00
10 SASI_Mm02_00323496 predicted 1199 154.00
11 SASI_Mm01_00151931 predicted 252 154.00
12 SASI_Mm01_00151936 predicted 274 154.00
13 SASI_Mm01_00151937 predicted 351 154.00
14 SASI_Mm01_00151938 predicted 306 154.00
15 SASI_Mm01_00151940 predicted 322 154.00
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183417 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350517 predicted 1257 154.00
2 SASI_Mm01_00073971 predicted 1716 154.00
3 SASI_Mm01_00073972 predicted 1565 154.00
4 SASI_Mm02_00350518 predicted 1571 154.00
5 SASI_Mm02_00350519 predicted 590 154.00
6 SASI_Mm01_00073973 predicted 1490 154.00
7 SASI_Mm02_00350520 predicted 425 154.00
8 SASI_Mm01_00073974 predicted 530 154.00
9 SASI_Mm01_00073978 predicted 1560 154.00
10 SASI_Mm02_00350521 predicted 1346 154.00
11 SASI_Mm01_00073970 predicted 269 154.00
12 SASI_Mm01_00073975 predicted 280 154.00
13 SASI_Mm01_00073976 predicted 353 154.00
14 SASI_Mm01_00073977 predicted 314 154.00
15 SASI_Mm01_00073979 predicted 332 154.00
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052827
VALIDATED
CDK2 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052827.x-652s1c1
Sequence:CCGGCCATCAAGCTAGCAGACTTTCTCGAGAAAGTCTGCTAGCTTGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052827.x-923s1c1
Sequence:CCGGTACTTCTATGCCTGATTACAACTCGAGTTGTAATCAGGCATAGAAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052827.1-489s1c1
Sequence:CCGGGATCTCAAGAAATTCATGGATCTCGAGATCCATGAATTTCTTGAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052827.1-908s1c1
Sequence:CCGGACGGAGCTTGTTATCGCAAATCTCGAGATTTGCGATAACAAGCTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052827.1-696s1c1
Sequence:CCGGCCTGTTCGTACTTACACCCATCTCGAGATGGGTGTAAGTACGAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052827.1-380s1c1
Sequence:CCGGCCGAGAGATCTCTCTGCTTAACTCGAGTTAAGCAGAGAGATCTCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052827.1-1316s1c1
Sequence:CCGGGCCTTCCTACACGTTAGATTTCTCGAGAAATCTAACGTGTAGGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052827.x-1797s1c1
Sequence:CCGGCATTCCAATCTATTGCTTCACCTCGAGGTGAAGCAATAGATTGGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052827
VALIDATED
CDK2 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052827.x-652s1c1
Sequence:CCGGCCATCAAGCTAGCAGACTTTCTCGAGAAAGTCTGCTAGCTTGATGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000010470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052827.x-923s1c1
Sequence:CCGGTACTTCTATGCCTGATTACAACTCGAGTTGTAATCAGGCATAGAAGTATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000039962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052827.1-489s1c1
Sequence:CCGGGATCTCAAGAAATTCATGGATCTCGAGATCCATGAATTTCTTGAGATCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000039961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052827.1-908s1c1
Sequence:CCGGACGGAGCTTGTTATCGCAAATCTCGAGATTTGCGATAACAAGCTCCGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000039960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052827.1-696s1c1
Sequence:CCGGCCTGTTCGTACTTACACCCATCTCGAGATGGGTGTAAGTACGAACAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000039959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052827.1-380s1c1
Sequence:CCGGCCGAGAGATCTCTCTGCTTAACTCGAGTTAAGCAGAGAGATCTCTCGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000039958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052827.1-1316s1c1
Sequence:CCGGGCCTTCCTACACGTTAGATTTCTCGAGAAATCTAACGTGTAGGAAGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000010471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052827.x-1797s1c1
Sequence:CCGGCATTCCAATCTATTGCTTCACCTCGAGGTGAAGCAATAGATTGGAATGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052827
VALIDATED
CDK2 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 2
Human
8 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000010469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052827.x-652s1c1
Sequence:CCGGCCATCAAGCTAGCAGACTTTCTCGAGAAAGTCTGCTAGCTTGATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052827.x-923s1c1
Sequence:CCGGTACTTCTATGCCTGATTACAACTCGAGTTGTAATCAGGCATAGAAGTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052827.1-489s1c1
Sequence:CCGGGATCTCAAGAAATTCATGGATCTCGAGATCCATGAATTTCTTGAGATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052827.1-908s1c1
Sequence:CCGGACGGAGCTTGTTATCGCAAATCTCGAGATTTGCGATAACAAGCTCCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052827.1-696s1c1
Sequence:CCGGCCTGTTCGTACTTACACCCATCTCGAGATGGGTGTAAGTACGAACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052827.1-380s1c1
Sequence:CCGGCCGAGAGATCTCTCTGCTTAACTCGAGTTAAGCAGAGAGATCTCTCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052827.1-1316s1c1
Sequence:CCGGGCCTTCCTACACGTTAGATTTCTCGAGAAATCTAACGTGTAGGAAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052827.x-1797s1c1
Sequence:CCGGCATTCCAATCTATTGCTTCACCTCGAGGTGAAGCAATAGATTGGAATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001798
VALIDATED
CDK2 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000587    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001798.x-1222s1c1
Sequence:CCGGGCCCTCTGAACTTGCCTTAAACTCGAGTTTAAGGCAAGTTCAGAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001798.x-932s1c1
Sequence:CCGGGCCTGATTACAAGCCAAGTTTCTCGAGAAACTTGGCTTGTAATCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001798.x-928s1c1
Sequence:CCGGCTATGCCTGATTACAAGCCAACTCGAGTTGGCTTGTAATCAGGCATAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001798.x-753s1c1
Sequence:CCGGCTCCTGGGCTGCAAATATTATCTCGAGATAATATTTGCAGCCCAGGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197236    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001798.2-1781s1c1
Sequence:CCGGGACAGGGATTGTGCTTCATTCCTCGAGGAATGAAGCACAATCCCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001798.2-1632s1c1
Sequence:CCGGCCAATCAGTTTATACCCTAGTCTCGAGACTAGGGTATAAACTGATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001798.2-402s1c1
Sequence:CCGGGAGCTTAACCATCCTAATATTCTCGAGAATATTAGGATGGTTAAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001798.2-621s1c1
Sequence:CCGGCCTCAGAATCTGCTTATTAACCTCGAGGTTAATAAGCAGATTCTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001798.2-391s1c1
Sequence:CCGGCTCTGCTTAAGGAGCTTAACCCTCGAGGGTTAAGCTCCTTAAGCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001798.2-1429s1c1
Sequence:CCGGCGTTAGATTTGCCGTACCAATCTCGAGATTGGTACGGCAAATCTAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001798.2-1080s1c1
Sequence:CCGGCACCCTTTCTTCCAGGATGTGCTCGAGCACATCCTGGAAGAAAGGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001798
VALIDATED
CDK2 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000587    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001798.x-1222s1c1
Sequence:CCGGGCCCTCTGAACTTGCCTTAAACTCGAGTTTAAGGCAAGTTCAGAGGGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000000588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001798.x-932s1c1
Sequence:CCGGGCCTGATTACAAGCCAAGTTTCTCGAGAAACTTGGCTTGTAATCAGGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000000590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001798.x-928s1c1
Sequence:CCGGCTATGCCTGATTACAAGCCAACTCGAGTTGGCTTGTAATCAGGCATAGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000000591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001798.x-753s1c1
Sequence:CCGGCTCCTGGGCTGCAAATATTATCTCGAGATAATATTTGCAGCCCAGGAGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000197236    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001798.2-1781s1c1
Sequence:CCGGGACAGGGATTGTGCTTCATTCCTCGAGGAATGAAGCACAATCCCTGTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000194868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001798.2-1632s1c1
Sequence:CCGGCCAATCAGTTTATACCCTAGTCTCGAGACTAGGGTATAAACTGATTGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000196690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001798.2-402s1c1
Sequence:CCGGGAGCTTAACCATCCTAATATTCTCGAGAATATTAGGATGGTTAAGCTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000195003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001798.2-621s1c1
Sequence:CCGGCCTCAGAATCTGCTTATTAACCTCGAGGTTAATAAGCAGATTCTGAGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000195701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001798.2-391s1c1
Sequence:CCGGCTCTGCTTAAGGAGCTTAACCCTCGAGGGTTAAGCTCCTTAAGCAGAGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000195700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001798.2-1429s1c1
Sequence:CCGGCGTTAGATTTGCCGTACCAATCTCGAGATTGGTACGGCAAATCTAACGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000199285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001798.2-1080s1c1
Sequence:CCGGCACCCTTTCTTCCAGGATGTGCTCGAGCACATCCTGGAAGAAAGGGTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001798
VALIDATED
CDK2 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 2
Human
11 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000000587    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001798.x-1222s1c1
Sequence:CCGGGCCCTCTGAACTTGCCTTAAACTCGAGTTTAAGGCAAGTTCAGAGGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001798.x-932s1c1
Sequence:CCGGGCCTGATTACAAGCCAAGTTTCTCGAGAAACTTGGCTTGTAATCAGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001798.x-928s1c1
Sequence:CCGGCTATGCCTGATTACAAGCCAACTCGAGTTGGCTTGTAATCAGGCATAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001798.x-753s1c1
Sequence:CCGGCTCCTGGGCTGCAAATATTATCTCGAGATAATATTTGCAGCCCAGGAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197236    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001798.2-1781s1c1
Sequence:CCGGGACAGGGATTGTGCTTCATTCCTCGAGGAATGAAGCACAATCCCTGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001798.2-1632s1c1
Sequence:CCGGCCAATCAGTTTATACCCTAGTCTCGAGACTAGGGTATAAACTGATTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001798.2-402s1c1
Sequence:CCGGGAGCTTAACCATCCTAATATTCTCGAGAATATTAGGATGGTTAAGCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001798.2-621s1c1
Sequence:CCGGCCTCAGAATCTGCTTATTAACCTCGAGGTTAATAAGCAGATTCTGAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001798.2-391s1c1
Sequence:CCGGCTCTGCTTAAGGAGCTTAACCCTCGAGGGTTAAGCTCCTTAAGCAGAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001798.2-1429s1c1
Sequence:CCGGCGTTAGATTTGCCGTACCAATCTCGAGATTGGTACGGCAAATCTAACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001798.2-1080s1c1
Sequence:CCGGCACCCTTTCTTCCAGGATGTGCTCGAGCACATCCTGGAAGAAAGGGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016756
VALIDATED
CDK2 MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 2
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016756.4-590s21c1
Sequence:CCGGTGTCCTTCACCGAGACCTTAACTCGAGTTAAGGTCTCGGTGAAGGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016756.1-299s1c1
Sequence:CCGGCCGAGAGATCTCTCTCCTTAACTCGAGTTAAGGAGAGAGATCTCTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016756.1-1010s1c1
Sequence:CCGGCCAGGATGTAACTAAACCAGTCTCGAGACTGGTTTAGTTACATCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016756.1-229s1c1
Sequence:CCGGCGGGAGAAGTTGTGGCGCTTACTCGAGTAAGCGCCACAACTTCTCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016756.1-851s1c1
Sequence:CCGGGCCTGATTATAAGCCAAGTTTCTCGAGAAACTTGGCTTATAATCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016756.4-947s21c1
Sequence:CCGGCAAGTGGGCTCGGCAAGATTTCTCGAGAAATCTTGCCGAGCCCACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016756.4-1419s21c1
Sequence:CCGGCTTAAGACTGTCTCATAATTACTCGAGTAATTATGAGACAGTCTTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350654    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016756.4-1349s21c1
Sequence:CCGGTTACTGAGAAGGATTGGTATTCTCGAGAATACCAATCCTTCTCAGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016756.4-392s21c1
Sequence:CCGGGGAACTTAATCACCCTAATATCTCGAGATATTAGGGTGATTAAGTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016756.4-1001s21c1
Sequence:CCGGACGGAGCTTGTTATCGCAAATCTCGAGATTTGCGATAACAAGCTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016756.4-914s21c1
Sequence:CCGGTACTTCTATGCCTGATTATAACTCGAGTTATAATCAGGCATAGAAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016756
VALIDATED
CDK2 MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 2
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016756.4-590s21c1
Sequence:CCGGTGTCCTTCACCGAGACCTTAACTCGAGTTAAGGTCTCGGTGAAGGACATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000023145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016756.1-299s1c1
Sequence:CCGGCCGAGAGATCTCTCTCCTTAACTCGAGTTAAGGAGAGAGATCTCTCGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000023148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016756.1-1010s1c1
Sequence:CCGGCCAGGATGTAACTAAACCAGTCTCGAGACTGGTTTAGTTACATCCTGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000023147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016756.1-229s1c1
Sequence:CCGGCGGGAGAAGTTGTGGCGCTTACTCGAGTAAGCGCCACAACTTCTCCCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000023146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016756.1-851s1c1
Sequence:CCGGGCCTGATTATAAGCCAAGTTTCTCGAGAAACTTGGCTTATAATCAGGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000361090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016756.4-947s21c1
Sequence:CCGGCAAGTGGGCTCGGCAAGATTTCTCGAGAAATCTTGCCGAGCCCACTTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000361025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016756.4-1419s21c1
Sequence:CCGGCTTAAGACTGTCTCATAATTACTCGAGTAATTATGAGACAGTCTTAAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000350654    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016756.4-1349s21c1
Sequence:CCGGTTACTGAGAAGGATTGGTATTCTCGAGAATACCAATCCTTCTCAGTAATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000321831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016756.4-392s21c1
Sequence:CCGGGGAACTTAATCACCCTAATATCTCGAGATATTAGGGTGATTAAGTTCCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000321766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016756.4-1001s21c1
Sequence:CCGGACGGAGCTTGTTATCGCAAATCTCGAGATTTGCGATAACAAGCTCCGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000321832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016756.4-914s21c1
Sequence:CCGGTACTTCTATGCCTGATTATAACTCGAGTTATAATCAGGCATAGAAGTATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016756
VALIDATED
CDK2 MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 2
Mouse
11 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000361089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016756.4-590s21c1
Sequence:CCGGTGTCCTTCACCGAGACCTTAACTCGAGTTAAGGTCTCGGTGAAGGACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016756.1-299s1c1
Sequence:CCGGCCGAGAGATCTCTCTCCTTAACTCGAGTTAAGGAGAGAGATCTCTCGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016756.1-1010s1c1
Sequence:CCGGCCAGGATGTAACTAAACCAGTCTCGAGACTGGTTTAGTTACATCCTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016756.1-229s1c1
Sequence:CCGGCGGGAGAAGTTGTGGCGCTTACTCGAGTAAGCGCCACAACTTCTCCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016756.1-851s1c1
Sequence:CCGGGCCTGATTATAAGCCAAGTTTCTCGAGAAACTTGGCTTATAATCAGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016756.4-947s21c1
Sequence:CCGGCAAGTGGGCTCGGCAAGATTTCTCGAGAAATCTTGCCGAGCCCACTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016756.4-1419s21c1
Sequence:CCGGCTTAAGACTGTCTCATAATTACTCGAGTAATTATGAGACAGTCTTAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350654    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016756.4-1349s21c1
Sequence:CCGGTTACTGAGAAGGATTGGTATTCTCGAGAATACCAATCCTTCTCAGTAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016756.4-392s21c1
Sequence:CCGGGGAACTTAATCACCCTAATATCTCGAGATATTAGGGTGATTAAGTTCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016756.4-1001s21c1
Sequence:CCGGACGGAGCTTGTTATCGCAAATCTCGAGATTTGCGATAACAAGCTCCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016756.4-914s21c1
Sequence:CCGGTACTTCTATGCCTGATTATAACTCGAGTTATAATCAGGCATAGAAGTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)