CDK3

cyclin-dependent kinase 3

27 Gene Product Result for

Species: Human CDK3(1018), chicken CDK3(429642), dog CDK3(483323), domestic cat CDK3(101082960), cow CDK3(618631), sheep CDK3(101107113), naked mole-rat Cdk3(101703908)

UniProtKB ID: Q00526

Gene ID:

Human(1018) Summary: This gene encodes a member of the cyclin-dependent protein kinase family. The protein promotes entry into S phase, in part by activating members of the E2F family of transcription factors. The protein also associates with cyclin C and phosphorylates the retinoblastoma 1 protein to promote exit from G0. [provided by RefSeq, Jul 2008]

chicken(429642) cyclin-dependent kinase 3

dog(483323) cyclin-dependent kinase 3

domestic cat(101082960) cyclin-dependent kinase 3

cow(618631) cyclin-dependent kinase 3

sheep(101107113) cyclin-dependent kinase 3

naked mole-rat(101703908) cyclin-dependent kinase 3

Custom Gene Products

Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product #	Description	Species Reactivity	Application	Add to Cart

HPA007420	Anti-CDK3 antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution	human	immunofluorescence, immunohistochemistry	pricing

SAB1410068	Anti-CDK3 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution	mouse, human	western blot	pricing

WH0001018M1	Monoclonal Anti-CDK3 antibody produced in mouse clone 3C12, purified immunoglobulin, buffered aqueous solution	human	ELISA, immunohistochemistry, western blot	pricing

Small Molecule - Inhibitor

Product #	Description	Species	Add to Cart

O0886	Olomoucine ≥98% (HPLC)	human, rat	pricing

Proteins

Product #	Description	Species	Add to Cart

C1124	CDK3/CyclinE1, active, GST tagged human PRECISIO^® Kinase, recombinant, expressed in baculovirus infected Sf9 cells, ≥70% (SDS-PAGE), buffered aqueous glycerol solution	human	pricing

APREST71411	PrEST Antigen CDK3 Prestige Antigens^™ Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

QPREST25675	SILu^™PrEST CDK3 SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

shRNA

Type	Description	Species	Add to Cart

SHCLNG-NM_001258	MISSION® shRNA Bacterial Glycerol Stock	human	pricing
SHCLND-NM_001258	MISSION® shRNA Plasmid DNA	human	pricing
SHCLNV-NM_001258	MISSION® shRNA Lentiviral Transduction Particles	human	pricing

esiRNA

Product #	Description	Species	Add to Cart

EHU147011	MISSION^® esiRNA esiRNA human CDK3 (esiRNA1)	human	pricing

EHU220861	MISSION^® esiRNA esiRNA targeting human CDK3	human	pricing

Related Products

Product #	Description	Add to Cart

14-487-M	Cdk3/Cyclin E Protein, active, 10 µg Active complex of recombinant full length human Cdk3 containing a C-terminal His6-tag & recombinant full-length human Cyclin E containing an N-terminal GST-tag, for use in Kinase Assays.	pricing

SYBR® Green Primers

Product #	Description

KSPQ12012	KiCqStart® SYBR® Green Primers Predesigned primers for gene expression analysis
KSGA2013	KiCqStart® SYBR® Green Primers Gene Arrays for expression analysis of gene families

Custom CRISPR Plasmid

Product #	Description

CRISPR	Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.

Product #	siRNA Type	Species

NM_001258	Rosetta Predictions	human	pricing

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_001258	Rosetta Predictions	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs01_00185672 predicted	654
2	SASI_Hs01_00185673 predicted	814
3	SASI_Hs02_00331442 predicted	1118
4	SASI_Hs02_00331443 predicted	1079
5	SASI_Hs01_00185674 predicted	228
6	SASI_Hs01_00185675 predicted	295
7	SASI_Hs02_00331444 predicted	1081
8	SASI_Hs02_00331445 predicted	1236
9	SASI_Hs01_00185676 predicted	295
10	SASI_Hs01_00185677 predicted	415
11	SASI_Hs01_00185678 predicted	720
12	SASI_Hs01_00185679 predicted	882
13	SASI_Hs01_00185680 predicted	651
14	SASI_Hs01_00185681 predicted	242

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_001258 VALIDATED	CDK3 MISSION shRNA Bacterial Glycerol Stock cyclin-dependent kinase 3	Human

20 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000367542
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001258.2-228s21c1
	Sequence:CCGGAGATCTCGCTGCTCAAGGAACCTCGAGGTTCCTTGAGCAGCGAGATCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000218303
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001258.2-710s21c1
	Sequence:GTACCGGCTCTTTCGTATCTTTCGTATGCTCGAGCATACGAAAGATACGAAAGAGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000010525
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001258.x-308s1c1
	Sequence:CCGGAGGAAGCTCTATCTGGTGTTTCTCGAGAAACACCAGATAGAGCTTCCTTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000484
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001258.x-618s1c1
	Sequence:CCGGGCAAGTTCTATACCACAGCTGCTCGAGCAGCTGTGGTATAGAACTTGCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199726
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.0	Cell Line: A549
	TRC Version: 1	Clone ID:NM_001258.1-441s1c1
	Sequence:CCGGGCCACTCACATCGGGTCATCCCTCGAGGGATGACCCGATGTGAGTGGCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000481
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_001258.x-1097s1c1
	Sequence:CCGGGAGAGCAAAGCACTAAGGAATCTCGAGATTCCTTAGTGCTTTGCTCTCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000482
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001258.x-721s1c1
	Sequence:CCGGGCTCTTTCGTATCTTTCGTATCTCGAGATACGAAAGATACGAAAGAGCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000367613
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001258.2-979s21c1
	Sequence:CCGGGCGATTCCGCCATTGAGAATGCTCGAGCATTCTCAATGGCGGAATCGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000367565
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001258.2-864s21c1
	Sequence:CCGGTCATGCAACTCCTGCAGTATGCTCGAGCATACTGCAGGAGTTGCATGATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000367504
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001258.2-124s21c1
	Sequence:CCGGGGTGGTGTACAAGGCCAAGAACTCGAGTTCTTGGCCTTGTACACCACCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000367569
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001258.2-288s21c1
	Sequence:CCGGACAACGAGAGGAAGCTCTATCCTCGAGGATAGAGCTTCCTCTCGTTGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199128
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001258.1-690s1c1
	Sequence:CCGGCCCTGTTTCCTGGTGACTCTGCTCGAGCAGAGTCACCAGGAAACAGGGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199563
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001258.1-985s1c1
	Sequence:CCGGGCTGCAGCGATTCCGCCATTGCTCGAGCAATGGCGGAATCGCTGCAGCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199624
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001258.1-833s1c1
	Sequence:CCGGGAAGAGATTGTGCCCAATCTGCTCGAGCAGATTGGGCACAATCTCTTCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199856
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001258.1-431s1c1
	Sequence:CCGGGTGAGTTTCTGCCACTCACATCTCGAGATGTGAGTGGCAGAAACTCACTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000200004
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001258.1-977s1c1
	Sequence:CCGGCAGTATGTGCTGCAGCGATTCCTCGAGGAATCGCTGCAGCACATACTGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000230929
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.88	Cell Line: A549
	TRC Version: 2	Clone ID:NM_001258.2-1396s21c1
	Sequence:CCGGCCAGTTCAGTCCCAAGTTAAACTCGAGTTTAACTTGGGACTGAACTGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000230928
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.59	Cell Line: A549
	TRC Version: 2	Clone ID:NM_001258.2-765s21c1
	Sequence:CCGGTCACCCAGCTGCCTGACTATACTCGAGTATAGTCAGGCAGCTGGGTGATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000230926
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001258.2-597s21c1
	Sequence:CCGGTCTTGGGCAGCAAGTTCTATACTCGAGTATAGAACTTGCTGCCCAAGATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000367638
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001258.2-172s21c1
	Sequence:CCGGGAAGAAGATCAGACTGGATTTCTCGAGAAATCCAGTCTGATCTTCTTCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_001258 VALIDATED	CDK3 MISSION shRNA shRNA Plasmid DNA cyclin-dependent kinase 3	Human

20 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000367542
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001258.2-228s21c1
	Sequence:CCGGAGATCTCGCTGCTCAAGGAACCTCGAGGTTCCTTGAGCAGCGAGATCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000218303
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001258.2-710s21c1
	Sequence:GTACCGGCTCTTTCGTATCTTTCGTATGCTCGAGCATACGAAAGATACGAAAGAGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000010525
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001258.x-308s1c1
	Sequence:CCGGAGGAAGCTCTATCTGGTGTTTCTCGAGAAACACCAGATAGAGCTTCCTTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000484
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001258.x-618s1c1
	Sequence:CCGGGCAAGTTCTATACCACAGCTGCTCGAGCAGCTGTGGTATAGAACTTGCTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199726
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.0	Cell Line: A549
	TRC Version: 1	Clone ID:NM_001258.1-441s1c1
	Sequence:CCGGGCCACTCACATCGGGTCATCCCTCGAGGGATGACCCGATGTGAGTGGCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000481
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_001258.x-1097s1c1
	Sequence:CCGGGAGAGCAAAGCACTAAGGAATCTCGAGATTCCTTAGTGCTTTGCTCTCTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000482
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001258.x-721s1c1
	Sequence:CCGGGCTCTTTCGTATCTTTCGTATCTCGAGATACGAAAGATACGAAAGAGCTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000367613
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001258.2-979s21c1
	Sequence:CCGGGCGATTCCGCCATTGAGAATGCTCGAGCATTCTCAATGGCGGAATCGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000367565
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001258.2-864s21c1
	Sequence:CCGGTCATGCAACTCCTGCAGTATGCTCGAGCATACTGCAGGAGTTGCATGATTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000367504
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001258.2-124s21c1
	Sequence:CCGGGGTGGTGTACAAGGCCAAGAACTCGAGTTCTTGGCCTTGTACACCACCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000367569
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001258.2-288s21c1
	Sequence:CCGGACAACGAGAGGAAGCTCTATCCTCGAGGATAGAGCTTCCTCTCGTTGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199128
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001258.1-690s1c1
	Sequence:CCGGCCCTGTTTCCTGGTGACTCTGCTCGAGCAGAGTCACCAGGAAACAGGGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199563
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001258.1-985s1c1
	Sequence:CCGGGCTGCAGCGATTCCGCCATTGCTCGAGCAATGGCGGAATCGCTGCAGCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199624
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001258.1-833s1c1
	Sequence:CCGGGAAGAGATTGTGCCCAATCTGCTCGAGCAGATTGGGCACAATCTCTTCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199856
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001258.1-431s1c1
	Sequence:CCGGGTGAGTTTCTGCCACTCACATCTCGAGATGTGAGTGGCAGAAACTCACTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000200004
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001258.1-977s1c1
	Sequence:CCGGCAGTATGTGCTGCAGCGATTCCTCGAGGAATCGCTGCAGCACATACTGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000230929
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.88	Cell Line: A549
	TRC Version: 2	Clone ID:NM_001258.2-1396s21c1
	Sequence:CCGGCCAGTTCAGTCCCAAGTTAAACTCGAGTTTAACTTGGGACTGAACTGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000230928
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.59	Cell Line: A549
	TRC Version: 2	Clone ID:NM_001258.2-765s21c1
	Sequence:CCGGTCACCCAGCTGCCTGACTATACTCGAGTATAGTCAGGCAGCTGGGTGATTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000230926
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001258.2-597s21c1
	Sequence:CCGGTCTTGGGCAGCAAGTTCTATACTCGAGTATAGAACTTGCTGCCCAAGATTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000367638
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001258.2-172s21c1
	Sequence:CCGGGAAGAAGATCAGACTGGATTTCTCGAGAAATCCAGTCTGATCTTCTTCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_001258 VALIDATED	CDK3 MISSION shRNA Lentiviral Transduction Particles cyclin-dependent kinase 3	Human

20 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000367542
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001258.2-228s21c1
	Sequence:CCGGAGATCTCGCTGCTCAAGGAACCTCGAGGTTCCTTGAGCAGCGAGATCTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000218303
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001258.2-710s21c1
	Sequence:GTACCGGCTCTTTCGTATCTTTCGTATGCTCGAGCATACGAAAGATACGAAAGAGTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000010525
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001258.x-308s1c1
	Sequence:CCGGAGGAAGCTCTATCTGGTGTTTCTCGAGAAACACCAGATAGAGCTTCCTTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000484
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001258.x-618s1c1
	Sequence:CCGGGCAAGTTCTATACCACAGCTGCTCGAGCAGCTGTGGTATAGAACTTGCTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199726
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.0	Cell Line: A549
	TRC Version: 1	Clone ID:NM_001258.1-441s1c1
	Sequence:CCGGGCCACTCACATCGGGTCATCCCTCGAGGGATGACCCGATGTGAGTGGCTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000481
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_001258.x-1097s1c1
	Sequence:CCGGGAGAGCAAAGCACTAAGGAATCTCGAGATTCCTTAGTGCTTTGCTCTCTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000482
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001258.x-721s1c1
	Sequence:CCGGGCTCTTTCGTATCTTTCGTATCTCGAGATACGAAAGATACGAAAGAGCTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000367613
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001258.2-979s21c1
	Sequence:CCGGGCGATTCCGCCATTGAGAATGCTCGAGCATTCTCAATGGCGGAATCGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000367565
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001258.2-864s21c1
	Sequence:CCGGTCATGCAACTCCTGCAGTATGCTCGAGCATACTGCAGGAGTTGCATGATTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000367504
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001258.2-124s21c1
	Sequence:CCGGGGTGGTGTACAAGGCCAAGAACTCGAGTTCTTGGCCTTGTACACCACCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000367569
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001258.2-288s21c1
	Sequence:CCGGACAACGAGAGGAAGCTCTATCCTCGAGGATAGAGCTTCCTCTCGTTGTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199128
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001258.1-690s1c1
	Sequence:CCGGCCCTGTTTCCTGGTGACTCTGCTCGAGCAGAGTCACCAGGAAACAGGGTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199563
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001258.1-985s1c1
	Sequence:CCGGGCTGCAGCGATTCCGCCATTGCTCGAGCAATGGCGGAATCGCTGCAGCTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199624
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001258.1-833s1c1
	Sequence:CCGGGAAGAGATTGTGCCCAATCTGCTCGAGCAGATTGGGCACAATCTCTTCTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199856
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001258.1-431s1c1
	Sequence:CCGGGTGAGTTTCTGCCACTCACATCTCGAGATGTGAGTGGCAGAAACTCACTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000200004
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001258.1-977s1c1
	Sequence:CCGGCAGTATGTGCTGCAGCGATTCCTCGAGGAATCGCTGCAGCACATACTGTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000230929
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.88	Cell Line: A549
	TRC Version: 2	Clone ID:NM_001258.2-1396s21c1
	Sequence:CCGGCCAGTTCAGTCCCAAGTTAAACTCGAGTTTAACTTGGGACTGAACTGGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000230928
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.59	Cell Line: A549
	TRC Version: 2	Clone ID:NM_001258.2-765s21c1
	Sequence:CCGGTCACCCAGCTGCCTGACTATACTCGAGTATAGTCAGGCAGCTGGGTGATTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000230926
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001258.2-597s21c1
	Sequence:CCGGTCTTGGGCAGCAAGTTCTATACTCGAGTATAGAACTTGCTGCCCAAGATTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000367638
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_001258.2-172s21c1
	Sequence:CCGGGAAGAAGATCAGACTGGATTTCTCGAGAAATCCAGTCTGATCTTCTTCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart