CDK6

cyclin-dependent kinase 6

337 Gene Product Result for

Synonyms: PLSTIRE

Species: Human CDK6(1021), Mouse Cdk6(12571), Rat Cdk6(114483), sheep CDK6(100144761), Domestic Rabbit CDK6(100009040), domestic guinea pig Cdk6(100732773), naked mole-rat Cdk6(101719908), Zebrafish cdk6(100034507), cow CDK6(511754), Horse CDK6(100061625), domestic cat CDK6(100037415), dog CDK6(609920), chicken CDK6(420558)

UniProtKB ID: Q00534

Gene ID:

Human(1021) Summary: The protein encoded by this gene is a member of the cyclin-dependent protein kinase (CDK) family. CDK family members are highly similar to the gene products of Saccharomyces cerevisiae cdc28, and Schizosaccharomyces pombe cdc2, and are known to be important regulators of cell cycle progression. This kinase is a catalytic subunit of the protein kinase complex that is important for cell cycle G1 phase progression and G1/S transition. The activity of this kinase first appears in mid-G1 phase, which is controlled by the regulatory subunits including D-type cyclins and members of INK4 family of CDK inhibitors. This kinase, as well as CDK4, has been shown to phosphorylate, and thus regulate the activity of, tumor suppressor protein Rb. Expression of this gene is up-regulated in some types of cancer. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Nov 2009]

Mouse(12571) cyclin-dependent kinase 6

Rat(114483) cyclin-dependent kinase 6

sheep(100144761) cyclin-dependent kinase 6

Domestic Rabbit(100009040) cyclin-dependent kinase 6

domestic guinea pig(100732773) cyclin-dependent kinase 6

naked mole-rat(101719908) cyclin-dependent kinase 6

Zebrafish(100034507) cyclin-dependent kinase 6

cow(511754) cyclin-dependent kinase 6

Horse(100061625) cyclin-dependent kinase 6

domestic cat(100037415) cyclin-dependent kinase 6

dog(609920) cyclin-dependent kinase 6

chicken(420558) cyclin-dependent kinase 6

Custom Gene Products

Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product #	Description	Species Reactivity	Application	Add to Cart

SAB4300595	Anti-CDK6 (Ab-13) antibody produced in rabbit affinity isolated antibody	mouse, human	immunofluorescence, immunohistochemistry	pricing

SAB4300596	Anti-CDK6 (Ab-24) antibody produced in rabbit affinity isolated antibody	human, rat, mouse	immunohistochemistry, western blot	pricing

HPA002637	Anti-CDK6 antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution	human, mouse, rat	immunofluorescence, immunohistochemistry, western blot	pricing

AV03005	Anti-CDK6 antibody produced in rabbit IgG fraction of antiserum	human	western blot	pricing

SAB4300279	Anti-phospho-CDK6 (pTyr¹³) antibody produced in rabbit affinity isolated antibody	rat, human, mouse	immunofluorescence, immunohistochemistry	pricing

SAB4300280	Anti-phospho-CDK6 (pTyr²⁴) antibody produced in rabbit affinity isolated antibody	mouse, rat, human	immunofluorescence, immunohistochemistry, western blot	pricing

WH0001021M1	Monoclonal Anti-CDK6 antibody produced in mouse clone 8H4, purified immunoglobulin, buffered aqueous solution	mouse, human, rat	ELISA, immunofluorescence, immunohistochemistry, proximity ligation assay, western blot	pricing

Small Molecule - Inhibitor

Product #	Description	Species	Add to Cart

60010	Kaempferol ≥97.0% (HPLC)	human, mouse	pricing

K0133	Kaempferol ≥90% (HPLC), powder	human, mouse	pricing

A3145	Apigenin ≥97% (TLC), from parsley, powder	human, mouse, rat	pricing

10798	Apigenin ≥95.0% (HPLC)	human, mouse, rat	pricing

SMB00702	Apigenin ≥97% (TLC), from citrus	human, mouse, rat	pricing

C80105	Chrysin 97%	human, mouse, rat	pricing

F4043	Fisetin ≥98%	human, mouse, rat	pricing

F505	Fisetin	human, mouse, rat	pricing

L9283	Luteolin ≥98% (TLC), powder	human, mouse, rat	pricing

62696	Luteolin ≥99.0% (TLC)	human, mouse, rat	pricing

O0886	Olomoucine ≥98% (HPLC)	human, rat	pricing

Zinc Finger Nucleases

Product #	Description	Add to Cart

CKOZFN1931	CompoZr^® Knockout ZFN Kit Human CDK6 (NM_001145306)	pricing

CKOZFN28494	CompoZr^® Knockout ZFN Kit Mouse Cdk6 (NM_009873.2)	pricing

CKOZFN51860	CompoZr^® Knockout ZFN Kit Rat Cdk6 (NM_001191861)	pricing

CKOZFND1931	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Human CDK6 (NM_001145306)	pricing

CKOZFND28494	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Mouse Cdk6 (NM_009873.2)	pricing

CKOZFND51860	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Rat Cdk6 (NM_001191861)	pricing

Proteins

Product #	Description	Species	Add to Cart

C1374	CDK6/CyclinD1, active, His/GST tagged human PRECISIO^® Kinase, recombinant, expressed in baculovirus infected Sf9 cells, ≥70% (SDS-PAGE), buffered aqueous glycerol solution	human	pricing

C1499	CDK6/CyclinD3, active, His tagged human PRECISIO^® Kinase, recombinant, expressed in baculovirus infected Sf9 cells, ≥70% (SDS-PAGE), buffered aqueous glycerol solution	human	pricing

APREST86426	PrEST Antigen CDK6 Prestige Antigens^™ Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

QPREST25678	SILu^™PrEST CDK6 SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

shRNA

Type	Description	Species	Add to Cart

SHCLNG-NM_009873	MISSION® shRNA Bacterial Glycerol Stock	mouse	pricing
SHCLND-NM_009873	MISSION® shRNA Plasmid DNA	mouse	pricing
SHCLNV-NM_009873	MISSION® shRNA Lentiviral Transduction Particles	mouse	pricing
SHCLNG-NM_001259	MISSION® shRNA Bacterial Glycerol Stock	human	pricing
SHCLND-NM_001259	MISSION® shRNA Plasmid DNA	human	pricing
SHCLNV-NM_001259	MISSION® shRNA Lentiviral Transduction Particles	human	pricing

esiRNA

Product #	Description	Species	Add to Cart

EHU033071	MISSION^® esiRNA esiRNA human CDK6 (esiRNA1)	human	pricing

EMU007671	MISSION^® esiRNA esiRNA targeting mouse Cdk6 (esiRNA1)	mouse	pricing

siRNA Nano Scale

Product #	Description	Species	Add to Cart

SIHK0362	MISSION^® siRNA Human Kinase CDK6 (siRNA1), Nano Scale 0.25 nmol	human	pricing

SIHK0363	MISSION^® siRNA Human Kinase CDK6 (siRNA2), Nano Scale 0.25 nmol	human	pricing

SIHK0364	MISSION^® siRNA Human Kinase CDK6 (siRNA3), Nano Scale 0.25 nmol	human	pricing

Related Products

Product #	Description	Add to Cart

MABC280	Anti-CDK6 Antibody, clone 1F9.1 Detect Cdk6 using this mouse monoclonal antibody, Anti-CDK6 Antibody, clone 1F9.1 validated for use in western blotting & ICC.	pricing

14-519-M	Cdk6/Cyclin D3 Protein, active, 250 µg Active, N-terminal, His6-tagged full length human Cdk6 complexed with N-terminal GST-tagged full-length human Cyclin D3, for use in Kinase Assays.	pricing

SYBR® Green Primers

Product #	Description

KSPQ12012	KiCqStart® SYBR® Green Primers Predesigned primers for gene expression analysis
KSGA2013	KiCqStart® SYBR® Green Primers Gene Arrays for expression analysis of gene families

Custom CRISPR Plasmid

Product #	Description

CRISPR	Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.

Product #	siRNA Type	Species

NM_001259	siRNAs that have been validated in the lab	human	pricing
XM_001068770	Rosetta Predictions	rat	pricing
XM_342638	Rosetta Predictions	rat	pricing
NM_009873	Rosetta Predictions	mouse	pricing

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_001259	siRNAs that have been validated in the lab	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs01_00048790 validated	1183
1	SASI_Hs01_00048791 validated	747
1	SASI_Hs01_00048792 validated	680
2	SASI_Hs02_00331446 predicted	1343
3	SASI_Hs01_00048794 predicted	754
4	SASI_Hs01_00048795 predicted	1208
5	SASI_Hs01_00048796 predicted	656
6	SASI_Hs01_00048797 predicted	995
7	SASI_Hs01_00048798 predicted	660
8	SASI_Hs02_00331447 predicted	1011
9	SASI_Hs01_00048793 predicted	899
10	SASI_Hs01_00048799 predicted	1060

siRNA

PRODUCT #	siRNA Type ?	SPECIES
XM_001068770	Rosetta Predictions	Rat

Ranking	siRNA ID	Sequence Start ?
1	SASI_Rn02_00325776 predicted	1283
2	SASI_Rn02_00325777 predicted	1276
3	SASI_Rn02_00325778 predicted	774
4	SASI_Rn02_00325779 predicted	823
5	SASI_Rn02_00325780 predicted	1295
6	SASI_Rn02_00325781 predicted	1287
7	SASI_Rn02_00325782 predicted	772
8	SASI_Rn02_00325783 predicted	1326
9	SASI_Rn02_00325784 predicted	814
10	SASI_Rn02_00325785 predicted	743

siRNA

PRODUCT #	siRNA Type ?	SPECIES
XM_342638	Rosetta Predictions	Rat

Ranking	siRNA ID	Sequence Start ?
1	SASI_Rn02_00394570 predicted	1447
2	SASI_Rn02_00394571 predicted	1458
3	SASI_Rn02_00394572 predicted	1451
4	SASI_Rn02_00394573 predicted	1595
5	SASI_Rn02_00394574 predicted	1446
6	SASI_Rn02_00394575 predicted	1576
7	SASI_Rn02_00394576 predicted	1575
8	SASI_Rn02_00394577 predicted	1574
9	SASI_Rn02_00394578 predicted	1495
10	SASI_Rn02_00394579 predicted	1502

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_009873	Rosetta Predictions	Mouse

Ranking	siRNA ID	Sequence Start ?
1	SASI_Mm01_00200220 predicted	872
2	SASI_Mm01_00200221 predicted	468
3	SASI_Mm01_00200222 predicted	367
4	SASI_Mm01_00200223 predicted	851
5	SASI_Mm01_00200224 predicted	402
6	SASI_Mm01_00200225 predicted	859
7	SASI_Mm01_00200227 predicted	418
8	SASI_Mm01_00200228 predicted	889
9	SASI_Mm01_00200229 predicted	523
10	SASI_Mm02_00317338 predicted	413
11	SASI_Mm01_00200226 predicted	843

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_009873 VALIDATED	CDK6 MISSION shRNA Bacterial Glycerol Stock cyclin-dependent kinase 6	Mouse

7 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000378274
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.59	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_009873.2-1175s21c1
	Sequence:CCGGCCAAGGAAACCACCTAGTTTACTCGAGTAAACTAGGTGGTTTCCTTGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023150
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.94	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_009873.1-670s1c1
	Sequence:CCGGCGGTTGCATCTTTGCAGAAATCTCGAGATTTCTGCAAAGATGCAACCGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000378483
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.69	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_009873.2-887s21c1
	Sequence:CCGGCTGAAATGCCTGACGTTTAATCTCGAGATTAAACGTCAGGCATTTCAGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023149
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_009873.1-895s1c1
	Sequence:CCGGCCTGACGTTTAATCCAGCTAACTCGAGTTAGCTGGATTAAACGTCAGGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023153
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_009873.1-830s1c1
	Sequence:CCGGGCTCAACCCATCGAGAAGTTTCTCGAGAAACTTCTCGATGGGTTGAGCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023152
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_009873.1-367s1c1
	Sequence:CCGGCTTGACCACTTACTTGGATAACTCGAGTTATCCAAGTAAGTGGTCAAGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023151
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.82	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_009873.1-873s1c1
	Sequence:CCGGGCAAAGACCTACTTCTGAAATCTCGAGATTTCAGAAGTAGGTCTTTGCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_009873 VALIDATED	CDK6 MISSION shRNA shRNA Plasmid DNA cyclin-dependent kinase 6	Mouse

7 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000378274
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.59	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_009873.2-1175s21c1
	Sequence:CCGGCCAAGGAAACCACCTAGTTTACTCGAGTAAACTAGGTGGTTTCCTTGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023150
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.94	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_009873.1-670s1c1
	Sequence:CCGGCGGTTGCATCTTTGCAGAAATCTCGAGATTTCTGCAAAGATGCAACCGTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000378483
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.69	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_009873.2-887s21c1
	Sequence:CCGGCTGAAATGCCTGACGTTTAATCTCGAGATTAAACGTCAGGCATTTCAGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023149
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_009873.1-895s1c1
	Sequence:CCGGCCTGACGTTTAATCCAGCTAACTCGAGTTAGCTGGATTAAACGTCAGGTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023153
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_009873.1-830s1c1
	Sequence:CCGGGCTCAACCCATCGAGAAGTTTCTCGAGAAACTTCTCGATGGGTTGAGCTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023152
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_009873.1-367s1c1
	Sequence:CCGGCTTGACCACTTACTTGGATAACTCGAGTTATCCAAGTAAGTGGTCAAGTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023151
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.82	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_009873.1-873s1c1
	Sequence:CCGGGCAAAGACCTACTTCTGAAATCTCGAGATTTCAGAAGTAGGTCTTTGCTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_009873 VALIDATED	CDK6 MISSION shRNA Lentiviral Transduction Particles cyclin-dependent kinase 6	Mouse

7 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000378274
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.59	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_009873.2-1175s21c1
	Sequence:CCGGCCAAGGAAACCACCTAGTTTACTCGAGTAAACTAGGTGGTTTCCTTGGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023150
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.94	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_009873.1-670s1c1
	Sequence:CCGGCGGTTGCATCTTTGCAGAAATCTCGAGATTTCTGCAAAGATGCAACCGTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000378483
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.69	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_009873.2-887s21c1
	Sequence:CCGGCTGAAATGCCTGACGTTTAATCTCGAGATTAAACGTCAGGCATTTCAGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023149
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_009873.1-895s1c1
	Sequence:CCGGCCTGACGTTTAATCCAGCTAACTCGAGTTAGCTGGATTAAACGTCAGGTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023153
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_009873.1-830s1c1
	Sequence:CCGGGCTCAACCCATCGAGAAGTTTCTCGAGAAACTTCTCGATGGGTTGAGCTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023152
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_009873.1-367s1c1
	Sequence:CCGGCTTGACCACTTACTTGGATAACTCGAGTTATCCAAGTAAGTGGTCAAGTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023151
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.82	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_009873.1-873s1c1
	Sequence:CCGGGCAAAGACCTACTTCTGAAATCTCGAGATTTCAGAAGTAGGTCTTTGCTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_001259 VALIDATED	CDK6 MISSION shRNA Bacterial Glycerol Stock cyclin-dependent kinase 6	Human

20 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000196337
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.75	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001259.5-1189s1c1
	Sequence:CCGGGTAACAGATATCGATGAACTACTCGAGTAGTTCATCGATATCTGTTACTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000196261
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.81	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001259.5-1180s1c1
	Sequence:CCGGGAGAAGTTTGTAACAGATATCCTCGAGGATATCTGTTACAAACTTCTCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000194893
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.8	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001259.5-4765s1c1
	Sequence:CCGGCATGAGATGTTCCTATCTTAACTCGAGTTAAGATAGGAACATCTCATGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000194866
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.56	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001259.5-1061s1c1
	Sequence:CCGGCAGATGTTGATCAACTAGGAACTCGAGTTCCTAGTTGATCAACATCTGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000196617
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001259.5-1021s1c1
	Sequence:CCGGGCAGAAATGTTTCGTAGAAAGCTCGAGCTTTCTACGAAACATTTCTGCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199114
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.66	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001259.5-1344s1c1
	Sequence:CCGGCCAGAACACCTCGGAGCTGAACTCGAGTTCAGCTCCGAGGTGTTCTGGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000010473
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001259.x-1113s1c1
	Sequence:CCGGTTAAGCTGATCCTGCGGAGAACTCGAGTTCTCCGCAGGATCAGCTTAATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039743
Product Details	Region:UNK
	TRC Version: 1	Clone ID:NM_001259.3-696s1c1
	Sequence:CCGGCGATCAAGACTTGACCACTTACTCGAGTAAGTGGTCAAGTCTTGATCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000487
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001259.x-833s1c1
	Sequence:CCGGGAAGAAGACTGGCCTAGAGATCTCGAGATCTCTAGGCCAGTCTTCTTCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000486
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001259.x-374s1c1
	Sequence:CCGGCGAACAGACAGAGAAACCAAACTCGAGTTTGGTTTCTCTGTCTGTTCGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000485
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001259.x-468s1c1
	Sequence:CCGGCCACTGAAACCATAAAGGATACTCGAGTATCCTTTATGGTTTCAGTGGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000009878
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001259.x-1007s1c1
	Sequence:CCGGCCATACTTCCAGGACCTGGAACTCGAGTTCCAGGTCCTGGAAGTATGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000010082
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001259.x-515s1c1
	Sequence:CCGGGACTTTCTTCATTCACACCGACTCGAGTCGGTGTGAATGAAGAAAGTCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000010081
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001259.x-1000s1c1
	Sequence:CCGGGTCTCACCCATACTTCCAGGACTCGAGTCCTGGAAGTATGGGTGAGACTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039747
Product Details Validated	Region:UNK	Mean KnockDown Level: 0.93	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001259.3-1051s1c1
	Sequence:CCGGCGTGGAAGTTCAGATGTTGATCTCGAGATCAACATCTGAACTTCCACGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039744
Product Details	Region:UNK
	TRC Version: 1	Clone ID:NM_001259.3-1297s1c1
	Sequence:CCGGGACCTGGAAAGGTGCAAAGAACTCGAGTTCTTTGCACCTTTCCAGGTCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039746
Product Details Validated	Region:UNK	Mean KnockDown Level: 0.89	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001259.3-1222s1c1
	Sequence:CCGGCTTCTGAAGTGTTTGACATTTCTCGAGAAATGTCAAACACTTCAGAAGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000194933
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001259.5-668s1c1
	Sequence:CCGGCCAAACTAACTTTAGTGTTTGCTCGAGCAAACACTAAAGTTAGTTTGGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000055435
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.83	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001259.x-720s1c2
	Sequence:CCGGTCTGGAGTGTTGGCTGCATATCTCGAGATATGCAGCCAACACTCCAGATTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039745
Product Details	Region:UNK
	TRC Version: 1	Clone ID:NM_001259.3-1171s1c1
	Sequence:CCGGCAACCAATTGAGAAGTTTGTACTCGAGTACAAACTTCTCAATTGGTTGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_001259 VALIDATED	CDK6 MISSION shRNA shRNA Plasmid DNA cyclin-dependent kinase 6	Human

20 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000196337
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.75	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001259.5-1189s1c1
	Sequence:CCGGGTAACAGATATCGATGAACTACTCGAGTAGTTCATCGATATCTGTTACTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000196261
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.81	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001259.5-1180s1c1
	Sequence:CCGGGAGAAGTTTGTAACAGATATCCTCGAGGATATCTGTTACAAACTTCTCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000194893
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.8	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001259.5-4765s1c1
	Sequence:CCGGCATGAGATGTTCCTATCTTAACTCGAGTTAAGATAGGAACATCTCATGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000194866
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.56	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001259.5-1061s1c1
	Sequence:CCGGCAGATGTTGATCAACTAGGAACTCGAGTTCCTAGTTGATCAACATCTGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000196617
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001259.5-1021s1c1
	Sequence:CCGGGCAGAAATGTTTCGTAGAAAGCTCGAGCTTTCTACGAAACATTTCTGCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199114
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.66	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001259.5-1344s1c1
	Sequence:CCGGCCAGAACACCTCGGAGCTGAACTCGAGTTCAGCTCCGAGGTGTTCTGGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000010473
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001259.x-1113s1c1
	Sequence:CCGGTTAAGCTGATCCTGCGGAGAACTCGAGTTCTCCGCAGGATCAGCTTAATTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039743
Product Details	Region:UNK
	TRC Version: 1	Clone ID:NM_001259.3-696s1c1
	Sequence:CCGGCGATCAAGACTTGACCACTTACTCGAGTAAGTGGTCAAGTCTTGATCGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000487
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001259.x-833s1c1
	Sequence:CCGGGAAGAAGACTGGCCTAGAGATCTCGAGATCTCTAGGCCAGTCTTCTTCTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000486
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001259.x-374s1c1
	Sequence:CCGGCGAACAGACAGAGAAACCAAACTCGAGTTTGGTTTCTCTGTCTGTTCGTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000485
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001259.x-468s1c1
	Sequence:CCGGCCACTGAAACCATAAAGGATACTCGAGTATCCTTTATGGTTTCAGTGGTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000009878
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001259.x-1007s1c1
	Sequence:CCGGCCATACTTCCAGGACCTGGAACTCGAGTTCCAGGTCCTGGAAGTATGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000010082
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001259.x-515s1c1
	Sequence:CCGGGACTTTCTTCATTCACACCGACTCGAGTCGGTGTGAATGAAGAAAGTCTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000010081
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001259.x-1000s1c1
	Sequence:CCGGGTCTCACCCATACTTCCAGGACTCGAGTCCTGGAAGTATGGGTGAGACTTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039747
Product Details Validated	Region:UNK	Mean KnockDown Level: 0.93	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001259.3-1051s1c1
	Sequence:CCGGCGTGGAAGTTCAGATGTTGATCTCGAGATCAACATCTGAACTTCCACGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039744
Product Details	Region:UNK
	TRC Version: 1	Clone ID:NM_001259.3-1297s1c1
	Sequence:CCGGGACCTGGAAAGGTGCAAAGAACTCGAGTTCTTTGCACCTTTCCAGGTCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039746
Product Details Validated	Region:UNK	Mean KnockDown Level: 0.89	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001259.3-1222s1c1
	Sequence:CCGGCTTCTGAAGTGTTTGACATTTCTCGAGAAATGTCAAACACTTCAGAAGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000194933
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001259.5-668s1c1
	Sequence:CCGGCCAAACTAACTTTAGTGTTTGCTCGAGCAAACACTAAAGTTAGTTTGGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000055435
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.83	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001259.x-720s1c2
	Sequence:CCGGTCTGGAGTGTTGGCTGCATATCTCGAGATATGCAGCCAACACTCCAGATTTTT
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039745
Product Details	Region:UNK
	TRC Version: 1	Clone ID:NM_001259.3-1171s1c1
	Sequence:CCGGCAACCAATTGAGAAGTTTGTACTCGAGTACAAACTTCTCAATTGGTTGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_001259 VALIDATED	CDK6 MISSION shRNA Lentiviral Transduction Particles cyclin-dependent kinase 6	Human

20 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000196337
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.75	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001259.5-1189s1c1
	Sequence:CCGGGTAACAGATATCGATGAACTACTCGAGTAGTTCATCGATATCTGTTACTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000196261
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.81	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001259.5-1180s1c1
	Sequence:CCGGGAGAAGTTTGTAACAGATATCCTCGAGGATATCTGTTACAAACTTCTCTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000194893
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.8	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001259.5-4765s1c1
	Sequence:CCGGCATGAGATGTTCCTATCTTAACTCGAGTTAAGATAGGAACATCTCATGTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000194866
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.56	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001259.5-1061s1c1
	Sequence:CCGGCAGATGTTGATCAACTAGGAACTCGAGTTCCTAGTTGATCAACATCTGTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000196617
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001259.5-1021s1c1
	Sequence:CCGGGCAGAAATGTTTCGTAGAAAGCTCGAGCTTTCTACGAAACATTTCTGCTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199114
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.66	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001259.5-1344s1c1
	Sequence:CCGGCCAGAACACCTCGGAGCTGAACTCGAGTTCAGCTCCGAGGTGTTCTGGTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000010473
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001259.x-1113s1c1
	Sequence:CCGGTTAAGCTGATCCTGCGGAGAACTCGAGTTCTCCGCAGGATCAGCTTAATTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039743
Product Details	Region:UNK
	TRC Version: 1	Clone ID:NM_001259.3-696s1c1
	Sequence:CCGGCGATCAAGACTTGACCACTTACTCGAGTAAGTGGTCAAGTCTTGATCGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000487
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001259.x-833s1c1
	Sequence:CCGGGAAGAAGACTGGCCTAGAGATCTCGAGATCTCTAGGCCAGTCTTCTTCTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000486
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001259.x-374s1c1
	Sequence:CCGGCGAACAGACAGAGAAACCAAACTCGAGTTTGGTTTCTCTGTCTGTTCGTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000485
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001259.x-468s1c1
	Sequence:CCGGCCACTGAAACCATAAAGGATACTCGAGTATCCTTTATGGTTTCAGTGGTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000009878
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001259.x-1007s1c1
	Sequence:CCGGCCATACTTCCAGGACCTGGAACTCGAGTTCCAGGTCCTGGAAGTATGGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000010082
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001259.x-515s1c1
	Sequence:CCGGGACTTTCTTCATTCACACCGACTCGAGTCGGTGTGAATGAAGAAAGTCTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000010081
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001259.x-1000s1c1
	Sequence:CCGGGTCTCACCCATACTTCCAGGACTCGAGTCCTGGAAGTATGGGTGAGACTTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039747
Product Details Validated	Region:UNK	Mean KnockDown Level: 0.93	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001259.3-1051s1c1
	Sequence:CCGGCGTGGAAGTTCAGATGTTGATCTCGAGATCAACATCTGAACTTCCACGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039744
Product Details	Region:UNK
	TRC Version: 1	Clone ID:NM_001259.3-1297s1c1
	Sequence:CCGGGACCTGGAAAGGTGCAAAGAACTCGAGTTCTTTGCACCTTTCCAGGTCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039746
Product Details Validated	Region:UNK	Mean KnockDown Level: 0.89	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001259.3-1222s1c1
	Sequence:CCGGCTTCTGAAGTGTTTGACATTTCTCGAGAAATGTCAAACACTTCAGAAGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000194933
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_001259.5-668s1c1
	Sequence:CCGGCCAAACTAACTTTAGTGTTTGCTCGAGCAAACACTAAAGTTAGTTTGGTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000055435
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.83	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_001259.x-720s1c2
	Sequence:CCGGTCTGGAGTGTTGGCTGCATATCTCGAGATATGCAGCCAACACTCCAGATTTTT
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039745
Product Details	Region:UNK
	TRC Version: 1	Clone ID:NM_001259.3-1171s1c1
	Sequence:CCGGCAACCAATTGAGAAGTTTGTACTCGAGTACAAACTTCTCAATTGGTTGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart