CDKN1B

cyclin-dependent kinase inhibitor 1B (p27, Kip1)

114 Gene Product Result for

Synonyms: CDKN4 KIP1 MEN1B MEN4 P27KIP1

Species: Human CDKN1B(1027), Mouse Cdkn1b(12576), Rat Cdkn1b(83571), chicken CDKN1B(374106), dog CDKN1B(403429), cow CDKN1B(512613), domestic cat CDKN1B(493958), chicken CDKN1B(769872), naked mole-rat Cdkn1b(101698721), domestic guinea pig Cdkn1b(100729359), sheep CDKN1B(100127219), Domestic Rabbit CDKN1B(100009037)

UniProtKB ID: P46527, Q16307, Q5U0H2, Q9BUS6

Gene ID:

Human(1027) Summary: This gene encodes a cyclin-dependent kinase inhibitor, which shares a limited similarity with CDK inhibitor CDKN1A/p21. The encoded protein binds to and prevents the activation of cyclin E-CDK2 or cyclin D-CDK4 complexes, and thus controls the cell cycle progression at G1. The degradation of this protein, which is triggered by its CDK dependent phosphorylation and subsequent ubiquitination by SCF complexes, is required for the cellular transition from quiescence to the proliferative state. [provided by RefSeq, Jul 2008]

Mouse(12576) cyclin-dependent kinase inhibitor 1B

Rat(83571) cyclin-dependent kinase inhibitor 1B

chicken(374106) cyclin-dependent kinase inhibitor 1B (p27, Kip1)

dog(403429) cyclin-dependent kinase inhibitor 1B (p27, Kip1)

cow(512613) cyclin-dependent kinase inhibitor 1B (p27, Kip1)

domestic cat(493958) cyclin-dependent kinase inhibitor 1B (p27, Kip1)

chicken(769872) cyclin-dependent kinase inhibitor 1B (p27, Kip1)

naked mole-rat(101698721) cyclin-dependent kinase inhibitor 1B (p27, Kip1)

domestic guinea pig(100729359) cyclin-dependent kinase inhibitor 1B (p27, Kip1)

sheep(100127219) cyclin-dependent kinase inhibitor 1B (p27, Kip1)

Domestic Rabbit(100009037) cyclin-dependent kinase inhibitor 1B (p27, Kip1)

Custom Gene Products

Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product #	Description	Species Reactivity	Application	Add to Cart

SAB4300420	Anti-CDKN1B (Ab-10) antibody produced in rabbit affinity isolated antibody	mouse, rat, human	immunohistochemistry, western blot	pricing

GW22609	Anti-CDKN1B antibody produced in chicken affinity isolated antibody, buffered aqueous solution	chicken	western blot	pricing

SAB1405601	Anti-CDKN1B antibody produced in mouse purified immunoglobulin, buffered aqueous solution	human	immunofluorescence, western blot	pricing

SAB5700634	Anti-CDKN1B antibody produced in rabbit	mouse, human, rat	immunofluorescence, immunohistochemistry, western blot	pricing

HPA059086	Anti-CDKN1B antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody	human	immunofluorescence, western blot	pricing

SAB2100391	Anti-CDKN1B antibody produced in rabbit affinity isolated antibody	human	western blot	pricing

06-445	Anti-Kip1 (p27) Antibody Upstate^®, from rabbit	human, rabbit, rat	immunohistochemistry, immunoprecipitation (IP), western blot	pricing

SAB2500562	Anti-KIP1/CDKN1B, Internal antibody produced in goat affinity isolated antibody, buffered aqueous solution	canine, human, cat	ELISA, immunohistochemistry, western blot	pricing

SAB4500068	Anti-p27 KIP1 antibody produced in rabbit affinity isolated antibody	human, rat, mouse	ELISA, immunohistochemistry, western blot	pricing

SAB4500067	Anti-p27 KIP1 antibody produced in rabbit affinity isolated antibody	human	ELISA, western blot	pricing

SAB4500069	Anti-p27 KIP1 antibody produced in rabbit affinity isolated antibody	human, rat, mouse	ELISA, western blot	pricing

SAB1306621	ANTI-P27KIP1 (N-TERM S12) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution	mouse, human	western blot	pricing

SAB2500733	Anti-P27KIP1/CDKN1B, C-Terminal antibody produced in goat affinity isolated antibody, buffered aqueous solution	bovine, human, rat, canine, mouse	ELISA, western blot	pricing

07-500	Anti-p47-phox (mouse) Antibody Upstate^®, from rabbit	mouse	western blot	pricing

SAB4300167	Anti-phospho-CDKN1B (pThr¹⁸⁷) antibody produced in rabbit affinity isolated antibody	human	immunohistochemistry, western blot	pricing

06-996	Anti-phospho-Kip1 (Thr187) Antibody Upstate^®, from rabbit	rat, mouse, human	western blot	pricing

SAB4504496	Anti-phospho-p27 Kip1 (pThr¹⁸⁷) antibody produced in rabbit affinity isolated antibody	human, mouse, rat	ELISA, western blot	pricing

SAB4504200	Anti-phospho-p27 Kip1 (pThr¹⁹⁸) antibody produced in rabbit affinity isolated antibody	mouse, rat, human	ELISA, western blot	pricing

SAB1305618	ANTI-PHOSPHO-P27KIP1(S140) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution	human		pricing

SAB1306298	ANTI-PHOSPHO-P27KIP1(T187) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution	human	immunohistochemistry, western blot	pricing

WH0001027M1	Monoclonal Anti-CDKN1B antibody produced in mouse clone 4B4-E6, purified immunoglobulin, buffered aqueous solution	human	ELISA, immunofluorescence, immunohistochemistry, proximity ligation assay, western blot	pricing

SAB1403659	Monoclonal Anti-CDKN1B, (C-terminal) antibody produced in mouse clone 2F4, purified immunoglobulin, buffered aqueous solution	human	ELISA, western blot	pricing

P2092	Monoclonal Anti-p27^Kip1 antibody produced in mouse clone DCS-72, ascites fluid	mouse, monkey, rat, canine, human	immunocytochemistry, immunoprecipitation (IP), western blot	pricing

Small Molecule - Inhibitor

Product #	Description	Species	Add to Cart

R7772	Roscovitine ≥98% (TLC)	human, mouse, rat	pricing

O0886	Olomoucine ≥98% (HPLC)	human, rat	pricing

Proteins

Product #	Description	Species	Add to Cart

23-024-M	p27 Protein complex, activated, 10 µg Activated complex of three (3) full length, recombinant human proteins: p27, Cyclin E1, & CDK2. Phosphorylated in vitro using CDK2/Cyclin E1. For use in Enzyme Assays. Behaves as a substrate in ubiquitin assays.	human	pricing

SRP5109	p27KIP1, GST tagged human recombinant, expressed in E. coli, ≥70% (SDS-PAGE), buffered aqueous glycerol solution	human	pricing

APREST89871	PrEST Antigen CDKN1B Prestige Antigens^™ Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

QPREST24583	SILu^™PrEST CDN1B SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

QPREST24584	SILu^™PrEST CDN1B SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

shRNA

Type	Description	Species	Add to Cart

SHCLNG-NM_009875	MISSION® shRNA Bacterial Glycerol Stock	mouse	pricing
SHCLND-NM_009875	MISSION® shRNA Plasmid DNA	mouse	pricing
SHCLNV-NM_009875	MISSION® shRNA Lentiviral Transduction Particles	mouse	pricing
SHCLNG-NM_004064	MISSION® shRNA Bacterial Glycerol Stock	human	pricing
SHCLND-NM_004064	MISSION® shRNA Plasmid DNA	human	pricing
SHCLNV-NM_004064	MISSION® shRNA Lentiviral Transduction Particles	human	pricing

esiRNA

Product #	Description	Species	Add to Cart

EHU025821	MISSION^® esiRNA targeting human CDKN1B	human	pricing

EMU028461	MISSION^® esiRNA targeting mouse Cdkn1b	mouse	pricing

SYBR® Green Primers

Product #	Description

KSPQ12012	KiCqStart® SYBR® Green Primers Predesigned primers for gene expression analysis
KSGA2013	KiCqStart® SYBR® Green Primers Gene Arrays for expression analysis of gene families

Custom CRISPR Plasmid

Product #	Description

CRISPR	Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.

Product #	siRNA Type	Species

NM_004064	siRNAs that have been validated in the lab	human	pricing
NM_031762	Rosetta Predictions	rat	pricing
NM_009875	Rosetta Predictions	mouse	pricing

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_004064	siRNAs that have been validated in the lab	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs01_00113637 validated	1165
2	SASI_Hs01_00113638 predicted	1279
3	SASI_Hs01_00113639 predicted	1401
4	SASI_Hs02_00336849 predicted	1118
5	SASI_Hs01_00113643 predicted	1265
6	SASI_Hs02_00336850 predicted	1175
7	SASI_Hs01_00113644 predicted	1038
8	SASI_Hs01_00113645 predicted	1500
9	SASI_Hs02_00336851 predicted	1251
10	SASI_Hs02_00336852 predicted	1300
11	SASI_Hs01_00113640 predicted	1118
12	SASI_Hs01_00113641 predicted	936
13	SASI_Hs01_00113642 predicted	1520
14	SASI_Hs01_00113646 predicted	1176

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_031762	Rosetta Predictions	Rat

Ranking	siRNA ID	Sequence Start ?
1	SASI_Rn01_00087579 predicted	893
2	SASI_Rn01_00087580 predicted	531
3	SASI_Rn02_00265180 predicted	672
4	SASI_Rn01_00087581 predicted	658
5	SASI_Rn01_00087582 predicted	934
6	SASI_Rn01_00087583 predicted	772
7	SASI_Rn01_00087584 predicted	836
8	SASI_Rn01_00087585 predicted	546
9	SASI_Rn02_00265181 predicted	207
10	SASI_Rn01_00087587 predicted	871
11	SASI_Rn01_00087586 predicted	807
12	SASI_Rn01_00087588 predicted	814

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_009875	Rosetta Predictions	Mouse

Ranking	siRNA ID	Sequence Start ?
1	SASI_Mm02_00317345 predicted	901
2	SASI_Mm02_00317346 predicted	1113
3	SASI_Mm02_00317347 predicted	1107
4	SASI_Mm01_00104471 predicted	982
5	SASI_Mm01_00104477 predicted	1090
6	SASI_Mm02_00317348 predicted	1219
7	SASI_Mm02_00317349 predicted	1279
8	SASI_Mm01_00104474 predicted	909
9	SASI_Mm01_00104475 predicted	808
10	SASI_Mm01_00104478 predicted	929
11	SASI_Mm01_00104469 predicted	1186
12	SASI_Mm01_00104470 predicted	1078
13	SASI_Mm01_00104472 predicted	977
14	SASI_Mm01_00104473 predicted	1210
15	SASI_Mm01_00104476 predicted	1379

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_009875 VALIDATED	CDKN1B MISSION shRNA Bacterial Glycerol Stock cyclin-dependent kinase inhibitor 1B (p27, Kip1)	Mouse

10 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000294885
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.84	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_009875.4-1108s21c1
	Sequence:CCGGACGTAAACAGCTCCGAATTAACTCGAGTTAATTCGGAGCTGTTTACGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000287390
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.87	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_009875.4-691s21c1
	Sequence:CCGGCGCAAGTGGAATTTCGACTTTCTCGAGAAAGTCGAAATTCCACTTGCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000071064
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.66	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_009875.2-887s1c1
	Sequence:CCGGCCGGCATTTGGTGGACCAAATCTCGAGATTTGGTCCACCAAATGCCGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000071065
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_009875.2-620s1c1
	Sequence:CCGGTGAAGAACTAACCCGGGACTTCTCGAGAAGTCCCGGGTTAGTTCTTCATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000071066
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_009875.2-855s1c1
	Sequence:CCGGCCTTTAATTGGGTCTCAGGCACTCGAGTGCCTGAGACCCAATTAAAGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000071063
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.88	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_009875.2-678s1c1
	Sequence:CCGGCGCAAGTGGAATTTCGACTTTCTCGAGAAAGTCGAAATTCCACTTGCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000071067
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.75	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_009875.2-608s1c1
	Sequence:CCGGCCCGGTCAATCATGAAGAACTCTCGAGAGTTCTTCATGATTGACCGGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000307475
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.71	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_009875.4-767s21c1
	Sequence:CCGGGCTTGCCCGAGTTCTACTACACTCGAGTGTAGTAGAACTCGGGCAAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000287391
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.6	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_009875.4-621s21c1
	Sequence:CCGGCCCGGTCAATCATGAAGAACTCTCGAGAGTTCTTCATGATTGACCGGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000294886
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.84	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_009875.4-1310s21c1
	Sequence:CCGGGATGTAGCATTGCGCAATTAGCTCGAGCTAATTGCGCAATGCTACATCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_009875 VALIDATED	CDKN1B MISSION shRNA shRNA Plasmid DNA cyclin-dependent kinase inhibitor 1B (p27, Kip1)	Mouse

10 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000294885
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.84	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_009875.4-1108s21c1
	Sequence:CCGGACGTAAACAGCTCCGAATTAACTCGAGTTAATTCGGAGCTGTTTACGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000287390
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.87	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_009875.4-691s21c1
	Sequence:CCGGCGCAAGTGGAATTTCGACTTTCTCGAGAAAGTCGAAATTCCACTTGCGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000071064
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.66	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_009875.2-887s1c1
	Sequence:CCGGCCGGCATTTGGTGGACCAAATCTCGAGATTTGGTCCACCAAATGCCGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000071065
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_009875.2-620s1c1
	Sequence:CCGGTGAAGAACTAACCCGGGACTTCTCGAGAAGTCCCGGGTTAGTTCTTCATTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000071066
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_009875.2-855s1c1
	Sequence:CCGGCCTTTAATTGGGTCTCAGGCACTCGAGTGCCTGAGACCCAATTAAAGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000071063
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.88	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_009875.2-678s1c1
	Sequence:CCGGCGCAAGTGGAATTTCGACTTTCTCGAGAAAGTCGAAATTCCACTTGCGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000071067
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.75	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_009875.2-608s1c1
	Sequence:CCGGCCCGGTCAATCATGAAGAACTCTCGAGAGTTCTTCATGATTGACCGGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000307475
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.71	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_009875.4-767s21c1
	Sequence:CCGGGCTTGCCCGAGTTCTACTACACTCGAGTGTAGTAGAACTCGGGCAAGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000287391
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.6	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_009875.4-621s21c1
	Sequence:CCGGCCCGGTCAATCATGAAGAACTCTCGAGAGTTCTTCATGATTGACCGGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000294886
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.84	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_009875.4-1310s21c1
	Sequence:CCGGGATGTAGCATTGCGCAATTAGCTCGAGCTAATTGCGCAATGCTACATCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_009875 VALIDATED	CDKN1B MISSION shRNA Lentiviral Transduction Particles cyclin-dependent kinase inhibitor 1B (p27, Kip1)	Mouse

10 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000294885
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.84	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_009875.4-1108s21c1
	Sequence:CCGGACGTAAACAGCTCCGAATTAACTCGAGTTAATTCGGAGCTGTTTACGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000287390
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.87	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_009875.4-691s21c1
	Sequence:CCGGCGCAAGTGGAATTTCGACTTTCTCGAGAAAGTCGAAATTCCACTTGCGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000071064
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.66	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_009875.2-887s1c1
	Sequence:CCGGCCGGCATTTGGTGGACCAAATCTCGAGATTTGGTCCACCAAATGCCGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000071065
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_009875.2-620s1c1
	Sequence:CCGGTGAAGAACTAACCCGGGACTTCTCGAGAAGTCCCGGGTTAGTTCTTCATTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000071066
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_009875.2-855s1c1
	Sequence:CCGGCCTTTAATTGGGTCTCAGGCACTCGAGTGCCTGAGACCCAATTAAAGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000071063
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.88	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_009875.2-678s1c1
	Sequence:CCGGCGCAAGTGGAATTTCGACTTTCTCGAGAAAGTCGAAATTCCACTTGCGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000071067
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.75	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_009875.2-608s1c1
	Sequence:CCGGCCCGGTCAATCATGAAGAACTCTCGAGAGTTCTTCATGATTGACCGGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000307475
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.71	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_009875.4-767s21c1
	Sequence:CCGGGCTTGCCCGAGTTCTACTACACTCGAGTGTAGTAGAACTCGGGCAAGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000287391
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.6	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_009875.4-621s21c1
	Sequence:CCGGCCCGGTCAATCATGAAGAACTCTCGAGAGTTCTTCATGATTGACCGGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000294886
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.84	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_009875.4-1310s21c1
	Sequence:CCGGGATGTAGCATTGCGCAATTAGCTCGAGCTAATTGCGCAATGCTACATCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_004064 VALIDATED	CDKN1B MISSION shRNA Bacterial Glycerol Stock cyclin-dependent kinase inhibitor 1B (p27, Kip1)	Human

14 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000009856
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.7	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_004064.x-901s1c1
	Sequence:CCGGAGCAATGCGCAGGAATAAGGCTCGAGCCTTATTCCTGCGCATTGCTCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000368691
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_004064.3-576s21c1
	Sequence:CCGGCGGTGGACCACGAAGAGTTAACTCGAGTTAACTCTTCGTGGTCCACCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000009857
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.55	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_004064.x-1752s1c1
	Sequence:CCGGAATGGTGATCACTCCAGGTACTCGAGTACCTGGAGTGATCACCATTCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039928
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.55	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_004064.2-2050s1c1
	Sequence:CCGGGTAGGATAAGTGAAATGGATACTCGAGTATCCATTTCACTTATCCTACTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039930
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.7	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_004064.2-636s1c1
	Sequence:CCGGGCGCAAGTGGAATTTCGATTTCTCGAGAAATCGAAATTCCACTTGCGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039931
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_004064.2-1041s1c1
	Sequence:CCGGCCTCAGAAGACGTCAAACGTACTCGAGTACGTTTGACGTCTTCTGAGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039932
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_004064.2-634s1c1
	Sequence:CCGGCAGCGCAAGTGGAATTTCGATCTCGAGATCGAAATTCCACTTGCGCTGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000009858
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_004064.x-2043s1c1
	Sequence:CCGGCACACTTGTAGGATAAGTGAACTCGAGTTCACTTATCCTACAAGTGTGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000295862
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_004064.3-841s21c1
	Sequence:CCGGTAACTCTGAGGACACGCATTTCTCGAGAAATGCGTGTCCTCAGAGTTATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000356317
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_004064.3-1064s21c1
	Sequence:CCGGACGTAAACAGCTCGAATTAAGCTCGAGCTTAATTCGAGCTGTTTACGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000356318
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_004064.3-1269s21c1
	Sequence:CCGGGATGTAGCATTATGCAATTAGCTCGAGCTAATTGCATAATGCTACATCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000288586
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_004064.3-643s21c1
	Sequence:CCGGGCGCAAGTGGAATTTCGATTTCTCGAGAAATCGAAATTCCACTTGCGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000295863
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_004064.3-1177s21c1
	Sequence:CCGGGGAATGGACATCCTGTATAAGCTCGAGCTTATACAGGATGTCCATTCCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000307476
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_004064.3-720s21c1
	Sequence:CCGGGCTTGCCCGAGTTCTACTACACTCGAGTGTAGTAGAACTCGGGCAAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_004064 VALIDATED	CDKN1B MISSION shRNA shRNA Plasmid DNA cyclin-dependent kinase inhibitor 1B (p27, Kip1)	Human

14 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000009856
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.7	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_004064.x-901s1c1
	Sequence:CCGGAGCAATGCGCAGGAATAAGGCTCGAGCCTTATTCCTGCGCATTGCTCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000368691
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_004064.3-576s21c1
	Sequence:CCGGCGGTGGACCACGAAGAGTTAACTCGAGTTAACTCTTCGTGGTCCACCGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000009857
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.55	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_004064.x-1752s1c1
	Sequence:CCGGAATGGTGATCACTCCAGGTACTCGAGTACCTGGAGTGATCACCATTCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000039928
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.55	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_004064.2-2050s1c1
	Sequence:CCGGGTAGGATAAGTGAAATGGATACTCGAGTATCCATTTCACTTATCCTACTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000039930
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.7	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_004064.2-636s1c1
	Sequence:CCGGGCGCAAGTGGAATTTCGATTTCTCGAGAAATCGAAATTCCACTTGCGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000039931
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_004064.2-1041s1c1
	Sequence:CCGGCCTCAGAAGACGTCAAACGTACTCGAGTACGTTTGACGTCTTCTGAGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000039932
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_004064.2-634s1c1
	Sequence:CCGGCAGCGCAAGTGGAATTTCGATCTCGAGATCGAAATTCCACTTGCGCTGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000009858
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_004064.x-2043s1c1
	Sequence:CCGGCACACTTGTAGGATAAGTGAACTCGAGTTCACTTATCCTACAAGTGTGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000295862
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_004064.3-841s21c1
	Sequence:CCGGTAACTCTGAGGACACGCATTTCTCGAGAAATGCGTGTCCTCAGAGTTATTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000356317
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_004064.3-1064s21c1
	Sequence:CCGGACGTAAACAGCTCGAATTAAGCTCGAGCTTAATTCGAGCTGTTTACGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000356318
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_004064.3-1269s21c1
	Sequence:CCGGGATGTAGCATTATGCAATTAGCTCGAGCTAATTGCATAATGCTACATCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000288586
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_004064.3-643s21c1
	Sequence:CCGGGCGCAAGTGGAATTTCGATTTCTCGAGAAATCGAAATTCCACTTGCGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000295863
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_004064.3-1177s21c1
	Sequence:CCGGGGAATGGACATCCTGTATAAGCTCGAGCTTATACAGGATGTCCATTCCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000307476
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_004064.3-720s21c1
	Sequence:CCGGGCTTGCCCGAGTTCTACTACACTCGAGTGTAGTAGAACTCGGGCAAGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_004064 VALIDATED	CDKN1B MISSION shRNA Lentiviral Transduction Particles cyclin-dependent kinase inhibitor 1B (p27, Kip1)	Human

14 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000009856
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.7	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_004064.x-901s1c1
	Sequence:CCGGAGCAATGCGCAGGAATAAGGCTCGAGCCTTATTCCTGCGCATTGCTCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000368691
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_004064.3-576s21c1
	Sequence:CCGGCGGTGGACCACGAAGAGTTAACTCGAGTTAACTCTTCGTGGTCCACCGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000009857
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.55	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_004064.x-1752s1c1
	Sequence:CCGGAATGGTGATCACTCCAGGTACTCGAGTACCTGGAGTGATCACCATTCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039928
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.55	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_004064.2-2050s1c1
	Sequence:CCGGGTAGGATAAGTGAAATGGATACTCGAGTATCCATTTCACTTATCCTACTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039930
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.7	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_004064.2-636s1c1
	Sequence:CCGGGCGCAAGTGGAATTTCGATTTCTCGAGAAATCGAAATTCCACTTGCGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039931
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_004064.2-1041s1c1
	Sequence:CCGGCCTCAGAAGACGTCAAACGTACTCGAGTACGTTTGACGTCTTCTGAGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039932
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_004064.2-634s1c1
	Sequence:CCGGCAGCGCAAGTGGAATTTCGATCTCGAGATCGAAATTCCACTTGCGCTGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000009858
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_004064.x-2043s1c1
	Sequence:CCGGCACACTTGTAGGATAAGTGAACTCGAGTTCACTTATCCTACAAGTGTGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000295862
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_004064.3-841s21c1
	Sequence:CCGGTAACTCTGAGGACACGCATTTCTCGAGAAATGCGTGTCCTCAGAGTTATTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000356317
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_004064.3-1064s21c1
	Sequence:CCGGACGTAAACAGCTCGAATTAAGCTCGAGCTTAATTCGAGCTGTTTACGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000356318
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_004064.3-1269s21c1
	Sequence:CCGGGATGTAGCATTATGCAATTAGCTCGAGCTAATTGCATAATGCTACATCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000288586
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_004064.3-643s21c1
	Sequence:CCGGGCGCAAGTGGAATTTCGATTTCTCGAGAAATCGAAATTCCACTTGCGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000295863
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_004064.3-1177s21c1
	Sequence:CCGGGGAATGGACATCCTGTATAAGCTCGAGCTTATACAGGATGTCCATTCCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000307476
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_004064.3-720s21c1
	Sequence:CCGGGCTTGCCCGAGTTCTACTACACTCGAGTGTAGTAGAACTCGGGCAAGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart