EMAIL THIS PAGE TO A FRIEND

CELSR1

cadherin, EGF LAG seven-pass G-type receptor 1

88 Gene Product Result for
Synonyms: CDHF9 FMI2 HFMI2 ME2
UniProtKB ID: Q9NYQ6, O95722, Q5TH47, Q9BWQ5, Q9Y506, Q9Y526
Gene ID:
Human(9620) Summary: The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. This particular member is a developmentally regulated, neural-specific gene which plays an unspecified role in early embryogenesis. [provided by RefSeq, Jul 2008]
Mouse(12614) cadherin, EGF LAG seven-pass G-type receptor 1 (flamingo homolog, Drosophila)
Rat(300128) cadherin, EGF LAG seven-pass G-type receptor 1
chicken(426068) cadherin, EGF LAG seven-pass G-type receptor 1 (flamingo homolog, Drosophila)
domestic cat(101097820) cadherin, EGF LAG seven-pass G-type receptor 1 (flamingo homolog, Drosophila)
cow(522422) cadherin, EGF LAG seven-pass G-type receptor 1
dog(481203) cadherin, EGF LAG seven-pass G-type receptor 1 (flamingo homolog, Drosophila)
domestic guinea pig(100724703) cadherin, EGF LAG seven-pass G-type receptor 1
naked mole-rat(101722292) cadherin, EGF LAG seven-pass G-type receptor 1
sheep(101111090) cadherin, EGF LAG seven-pass G-type receptor 1 (flamingo homolog, Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014246 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014246 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014246 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009886 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009886 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009886 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014246 siRNAs that have been validated in the lab human pricing
XM_001070474 Rosetta Predictions rat pricing
XM_001078424 Rosetta Predictions rat pricing
NM_009886 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014246 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152725 validated 3084
2 SASI_Hs01_00152723 predicted 4706
3 SASI_Hs01_00152724 predicted 4910
4 SASI_Hs01_00152726 predicted 6784
5 SASI_Hs01_00152727 predicted 8443
6 SASI_Hs01_00152728 predicted 2874
7 SASI_Hs01_00152729 predicted 8019
8 SASI_Hs01_00152730 predicted 6537
9 SASI_Hs01_00152731 predicted 7890
10 SASI_Hs01_00152732 predicted 4595
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070474 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00331767 predicted 6409
2 SASI_Rn02_00331768 predicted 1512
3 SASI_Rn02_00331769 predicted 1053
4 SASI_Rn02_00331770 predicted 2063
5 SASI_Rn02_00331771 predicted 4937
6 SASI_Rn02_00331772 predicted 7904
7 SASI_Rn02_00331773 predicted 7703
8 SASI_Rn02_00331774 predicted 7370
9 SASI_Rn02_00331775 predicted 9209
10 SASI_Rn02_00331776 predicted 1000
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078424 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00360734 predicted 1516
2 SASI_Rn02_00360735 predicted 2572
3 SASI_Rn02_00360736 predicted 1060
4 SASI_Rn02_00360737 predicted 4939
5 SASI_Rn02_00360738 predicted 7698
6 SASI_Rn02_00360739 predicted 7368
7 SASI_Rn02_00360740 predicted 2727
8 SASI_Rn02_00360741 predicted 9207
9 SASI_Rn02_00360742 predicted 1000
10 SASI_Rn02_00360743 predicted 6585
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009886 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114164 predicted 1148
2 SASI_Mm02_00317372 predicted 2810
3 SASI_Mm02_00317373 predicted 2570
4 SASI_Mm01_00114165 predicted 6699
5 SASI_Mm02_00317374 predicted 4313
6 SASI_Mm02_00317375 predicted 999
7 SASI_Mm01_00114167 predicted 2922
8 SASI_Mm01_00114168 predicted 3008
9 SASI_Mm01_00114169 predicted 5868
10 SASI_Mm01_00114170 predicted 6414
11 SASI_Mm01_00114161 predicted 2582
12 SASI_Mm01_00114162 predicted 1519
13 SASI_Mm01_00114163 predicted 5704
14 SASI_Mm01_00114166 predicted 1534
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014246
VALIDATED
CELSR1 MISSION shRNA Bacterial Glycerol Stock
cadherin, EGF LAG seven-pass G-type receptor 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008239    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014246.1-9176s1c1
Sequence:CCGGCCAGACACAAAGGTCTTGGTTCTCGAGAACCAAGACCTTTGTGTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014246.1-7910s1c1
Sequence:CCGGCCTGCCAAAGAAAGCACCATTCTCGAGAATGGTGCTTTCTTTGGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014246.1-2989s1c1
Sequence:CCGGCCCATGTTTGAGAAGGACGAACTCGAGTTCGTCCTTCTCAAACATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014246.1-4988s1c1
Sequence:CCGGCCTGTGTCAACAGGTGGAATACTCGAGTATTCCACCTGTTGACACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014246.1-1581s1c1
Sequence:CCGGCCAGAAATACTCGCTGAGCATCTCGAGATGCTCAGCGAGTATTTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_014246.1-7913s21c1
Sequence:CCGGGCCAAAGAAAGCACCATTATTCTCGAGAATAATGGTGCTTTCTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_014246.1-4601s21c1
Sequence:CCGGACTACAACAAGCCCAATATTGCTCGAGCAATATTGGGCTTGTTGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_014246.1-2597s21c1
Sequence:CCGGACAACGGCATCCCGCAGAAATCTCGAGATTTCTGCGGGATGCCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014246.1-9289s21c1
Sequence:CCGGGTCCTAAGACTGCAGTCAAAGCTCGAGCTTTGACTGCAGTCTTAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014246.1-2989s21c1
Sequence:CCGGCCCATGTTTGAGAAGGACGAACTCGAGTTCGTCCTTCTCAAACATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014246.1-4988s21c1
Sequence:CCGGCCTGTGTCAACAGGTGGAATACTCGAGTATTCCACCTGTTGACACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_014246.1-9539s21c1
Sequence:CCGGAGGAGGTGCAACCTGTATATACTCGAGTATATACAGGTTGCACCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014246.1-1581s21c1
Sequence:CCGGCCAGAAATACTCGCTGAGCATCTCGAGATGCTCAGCGAGTATTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014246
VALIDATED
CELSR1 MISSION shRNA shRNA Plasmid DNA
cadherin, EGF LAG seven-pass G-type receptor 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008239    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014246.1-9176s1c1
Sequence:CCGGCCAGACACAAAGGTCTTGGTTCTCGAGAACCAAGACCTTTGTGTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014246.1-7910s1c1
Sequence:CCGGCCTGCCAAAGAAAGCACCATTCTCGAGAATGGTGCTTTCTTTGGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014246.1-2989s1c1
Sequence:CCGGCCCATGTTTGAGAAGGACGAACTCGAGTTCGTCCTTCTCAAACATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014246.1-4988s1c1
Sequence:CCGGCCTGTGTCAACAGGTGGAATACTCGAGTATTCCACCTGTTGACACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014246.1-1581s1c1
Sequence:CCGGCCAGAAATACTCGCTGAGCATCTCGAGATGCTCAGCGAGTATTTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_014246.1-7913s21c1
Sequence:CCGGGCCAAAGAAAGCACCATTATTCTCGAGAATAATGGTGCTTTCTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_014246.1-4601s21c1
Sequence:CCGGACTACAACAAGCCCAATATTGCTCGAGCAATATTGGGCTTGTTGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_014246.1-2597s21c1
Sequence:CCGGACAACGGCATCCCGCAGAAATCTCGAGATTTCTGCGGGATGCCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014246.1-9289s21c1
Sequence:CCGGGTCCTAAGACTGCAGTCAAAGCTCGAGCTTTGACTGCAGTCTTAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014246.1-2989s21c1
Sequence:CCGGCCCATGTTTGAGAAGGACGAACTCGAGTTCGTCCTTCTCAAACATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014246.1-4988s21c1
Sequence:CCGGCCTGTGTCAACAGGTGGAATACTCGAGTATTCCACCTGTTGACACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_014246.1-9539s21c1
Sequence:CCGGAGGAGGTGCAACCTGTATATACTCGAGTATATACAGGTTGCACCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014246.1-1581s21c1
Sequence:CCGGCCAGAAATACTCGCTGAGCATCTCGAGATGCTCAGCGAGTATTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014246
VALIDATED
CELSR1 MISSION shRNA Lentiviral Transduction Particles
cadherin, EGF LAG seven-pass G-type receptor 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008239    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014246.1-9176s1c1
Sequence:CCGGCCAGACACAAAGGTCTTGGTTCTCGAGAACCAAGACCTTTGTGTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014246.1-7910s1c1
Sequence:CCGGCCTGCCAAAGAAAGCACCATTCTCGAGAATGGTGCTTTCTTTGGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014246.1-2989s1c1
Sequence:CCGGCCCATGTTTGAGAAGGACGAACTCGAGTTCGTCCTTCTCAAACATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014246.1-4988s1c1
Sequence:CCGGCCTGTGTCAACAGGTGGAATACTCGAGTATTCCACCTGTTGACACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014246.1-1581s1c1
Sequence:CCGGCCAGAAATACTCGCTGAGCATCTCGAGATGCTCAGCGAGTATTTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_014246.1-7913s21c1
Sequence:CCGGGCCAAAGAAAGCACCATTATTCTCGAGAATAATGGTGCTTTCTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_014246.1-4601s21c1
Sequence:CCGGACTACAACAAGCCCAATATTGCTCGAGCAATATTGGGCTTGTTGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_014246.1-2597s21c1
Sequence:CCGGACAACGGCATCCCGCAGAAATCTCGAGATTTCTGCGGGATGCCGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014246.1-9289s21c1
Sequence:CCGGGTCCTAAGACTGCAGTCAAAGCTCGAGCTTTGACTGCAGTCTTAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014246.1-2989s21c1
Sequence:CCGGCCCATGTTTGAGAAGGACGAACTCGAGTTCGTCCTTCTCAAACATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014246.1-4988s21c1
Sequence:CCGGCCTGTGTCAACAGGTGGAATACTCGAGTATTCCACCTGTTGACACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_014246.1-9539s21c1
Sequence:CCGGAGGAGGTGCAACCTGTATATACTCGAGTATATACAGGTTGCACCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014246.1-1581s21c1
Sequence:CCGGCCAGAAATACTCGCTGAGCATCTCGAGATGCTCAGCGAGTATTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009886
CELSR1 MISSION shRNA Bacterial Glycerol Stock
cadherin, EGF LAG seven-pass G-type receptor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009886.1-2370s1c1
Sequence:CCGGCGCAGGTCTTTATCAACGTTACTCGAGTAACGTTGATAAAGACCTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009886.1-5275s1c1
Sequence:CCGGCCAGATTCTCAACAGCTACATCTCGAGATGTAGCTGTTGAGAATCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009886.1-1071s1c1
Sequence:CCGGCCGTAACTGTCAGTGACACTACTCGAGTAGTGTCACTGACAGTTACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009886.1-4952s1c1
Sequence:CCGGGCTGCGTTTATTGCCAACAATCTCGAGATTGTTGGCAATAAACGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009886.1-3632s1c1
Sequence:CCGGCGCGTGACCATCATTACAGATCTCGAGATCTGTAATGATGGTCACGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009886
CELSR1 MISSION shRNA shRNA Plasmid DNA
cadherin, EGF LAG seven-pass G-type receptor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009886.1-2370s1c1
Sequence:CCGGCGCAGGTCTTTATCAACGTTACTCGAGTAACGTTGATAAAGACCTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009886.1-5275s1c1
Sequence:CCGGCCAGATTCTCAACAGCTACATCTCGAGATGTAGCTGTTGAGAATCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009886.1-1071s1c1
Sequence:CCGGCCGTAACTGTCAGTGACACTACTCGAGTAGTGTCACTGACAGTTACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009886.1-4952s1c1
Sequence:CCGGGCTGCGTTTATTGCCAACAATCTCGAGATTGTTGGCAATAAACGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009886.1-3632s1c1
Sequence:CCGGCGCGTGACCATCATTACAGATCTCGAGATCTGTAATGATGGTCACGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009886
CELSR1 MISSION shRNA Lentiviral Transduction Particles
cadherin, EGF LAG seven-pass G-type receptor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009886.1-2370s1c1
Sequence:CCGGCGCAGGTCTTTATCAACGTTACTCGAGTAACGTTGATAAAGACCTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009886.1-5275s1c1
Sequence:CCGGCCAGATTCTCAACAGCTACATCTCGAGATGTAGCTGTTGAGAATCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009886.1-1071s1c1
Sequence:CCGGCCGTAACTGTCAGTGACACTACTCGAGTAGTGTCACTGACAGTTACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009886.1-4952s1c1
Sequence:CCGGGCTGCGTTTATTGCCAACAATCTCGAGATTGTTGGCAATAAACGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009886.1-3632s1c1
Sequence:CCGGCGCGTGACCATCATTACAGATCTCGAGATCTGTAATGATGGTCACGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)