EMAIL THIS PAGE TO A FRIEND

CELSR2

cadherin, EGF LAG seven-pass G-type receptor 2

172 Gene Product Result for
Synonyms: CDHF10 EGFL2 Flamingo1 MEGF3
UniProtKB ID: Q9HCU4, Q5T2Y7, Q92566
Gene ID:
Human(1952) Summary: The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. The specific function of this particular member has not been determined. [provided by RefSeq, Jul 2008]
Mouse(53883) cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo homolog, Drosophila)
Rat(83465) cadherin, EGF LAG seven-pass G-type receptor 2
Zebrafish(560426) cadherin, EGF LAG seven-pass G-type receptor 2
chicken(430641) cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo homolog, Drosophila)
dog(479916) cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo homolog, Drosophila)
Horse(100061311) cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo homolog, Drosophila)
cow(538194) cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo homolog, Drosophila)
domestic cat(101098318) cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo homolog, Drosophila)
Zebrafish(100535379) cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo homolog, Drosophila)
sheep(101103606) cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo homolog, Drosophila)
naked mole-rat(101696520) cadherin, EGF LAG seven-pass G-type receptor 2
domestic guinea pig(100730038) cadherin, EGF LAG seven-pass G-type receptor 2
Gene Class: Cell_Adhesion
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2900493 Anti-CELSR2 / EGFL2 antibody produced in rabbit affinity isolated antibody mouse, bovine, monkey, dog, hamster, horse, rat, rabbit, human
immunohistochemistry pricing
HPA013952 Anti-CELSR2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4500708 Anti-CELSR2, C-Terminal antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001408 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001408 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001408 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_017392 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_017392 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_017392 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001408 Rosetta Predictions human pricing
XM_001070611 Rosetta Predictions rat pricing
XM_001076220 Rosetta Predictions rat pricing
NM_001004177 Rosetta Predictions mouse pricing
NM_017392 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001408 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022562 predicted 2201
2 SASI_Hs01_00022563 predicted 2716
3 SASI_Hs01_00022564 predicted 2589
4 SASI_Hs01_00022565 predicted 7874
5 SASI_Hs01_00022566 predicted 6121
6 SASI_Hs01_00022567 predicted 7190
7 SASI_Hs01_00022568 predicted 2407
8 SASI_Hs01_00022569 predicted 6469
9 SASI_Hs02_00331793 predicted 1879
10 SASI_Hs01_00022571 predicted 5539
11 SASI_Hs01_00022570 predicted 4775
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070611 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00332215 predicted 1382
2 SASI_Rn02_00332216 predicted 5452
3 SASI_Rn02_00332217 predicted 1077
4 SASI_Rn02_00332218 predicted 7129
5 SASI_Rn02_00332219 predicted 677
6 SASI_Rn02_00332220 predicted 6935
7 SASI_Rn02_00332221 predicted 2878
8 SASI_Rn02_00332222 predicted 1585
9 SASI_Rn02_00332223 predicted 1820
10 SASI_Rn02_00332224 predicted 6413
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076220 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00352421 predicted 1382
2 SASI_Rn02_00352422 predicted 5449
3 SASI_Rn02_00352423 predicted 1083
4 SASI_Rn02_00352424 predicted 7137
5 SASI_Rn02_00352425 predicted 679
6 SASI_Rn02_00352426 predicted 6938
7 SASI_Rn02_00352427 predicted 2883
8 SASI_Rn02_00352428 predicted 1580
9 SASI_Rn02_00352429 predicted 1825
10 SASI_Rn02_00352430 predicted 6412
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004177 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00286496 predicted 1381
2 SASI_Mm02_00286497 predicted 674
3 SASI_Mm02_00286498 predicted 6295
4 SASI_Mm02_00286499 predicted 4709
5 SASI_Mm02_00286500 predicted 1834
6 SASI_Mm02_00286501 predicted 1581
7 SASI_Mm02_00286502 predicted 1363
8 SASI_Mm02_00286503 predicted 3982
9 SASI_Mm02_00286504 predicted 6193
10 SASI_Mm02_00286505 predicted 2880
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017392 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086872 predicted 1378
2 SASI_Mm01_00086873 predicted 673
3 SASI_Mm02_00323891 predicted 6299
4 SASI_Mm01_00086874 predicted 4710
5 SASI_Mm01_00086875 predicted 1831
6 SASI_Mm01_00086877 predicted 1577
7 SASI_Mm01_00086878 predicted 1371
8 SASI_Mm02_00323892 predicted 3981
9 SASI_Mm02_00323893 predicted 6196
10 SASI_Mm01_00086881 predicted 2877
11 SASI_Mm01_00086876 predicted 5572
12 SASI_Mm01_00086879 predicted 3304
13 SASI_Mm01_00086880 predicted 3490
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001408
VALIDATED
CELSR2 MISSION shRNA Bacterial Glycerol Stock
cadherin, EGF LAG seven-pass G-type receptor 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356824    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001408.2-8894s21c1
Sequence:CCGGTGCTCCTGTCTTGTGCTTTATCTCGAGATAAAGCACAAGACAGGAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001408.2-8790s21c1
Sequence:CCGGACTCGTCAGGCTCCGAATTTCCTCGAGGAAATTCGGAGCCTGACGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001408.2-5205s21c1
Sequence:CCGGCCATTCTGTCCTTCGATTATGCTCGAGCATAATCGAAGGACAGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001408.1-4724s1c1
Sequence:CCGGGCACATAGACATGGCTGACTTCTCGAGAAGTCAGCCATGTCTATGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001408.1-2207s1c1
Sequence:CCGGCCACTATACAGTGAATGTTAACTCGAGTTAACATTCACTGTATAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001408.1-7184s1c1
Sequence:CCGGGCCACTGAAGACACTGACATACTCGAGTATGTCAGTGTCTTCAGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011239    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001408.1-10182s1c1
Sequence:CCGGCCAAGCATGTATTCCAGACTTCTCGAGAAGTCTGGAATACATGCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001408.1-6579s1c1
Sequence:CCGGCGCTTGGACAAAGGGAACTTTCTCGAGAAAGTTCCCTTTGTCCAAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001408
VALIDATED
CELSR2 MISSION shRNA shRNA Plasmid DNA
cadherin, EGF LAG seven-pass G-type receptor 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356824    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001408.2-8894s21c1
Sequence:CCGGTGCTCCTGTCTTGTGCTTTATCTCGAGATAAAGCACAAGACAGGAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001408.2-8790s21c1
Sequence:CCGGACTCGTCAGGCTCCGAATTTCCTCGAGGAAATTCGGAGCCTGACGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001408.2-5205s21c1
Sequence:CCGGCCATTCTGTCCTTCGATTATGCTCGAGCATAATCGAAGGACAGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001408.1-4724s1c1
Sequence:CCGGGCACATAGACATGGCTGACTTCTCGAGAAGTCAGCCATGTCTATGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001408.1-2207s1c1
Sequence:CCGGCCACTATACAGTGAATGTTAACTCGAGTTAACATTCACTGTATAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001408.1-7184s1c1
Sequence:CCGGGCCACTGAAGACACTGACATACTCGAGTATGTCAGTGTCTTCAGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011239    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001408.1-10182s1c1
Sequence:CCGGCCAAGCATGTATTCCAGACTTCTCGAGAAGTCTGGAATACATGCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001408.1-6579s1c1
Sequence:CCGGCGCTTGGACAAAGGGAACTTTCTCGAGAAAGTTCCCTTTGTCCAAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001408
VALIDATED
CELSR2 MISSION shRNA Lentiviral Transduction Particles
cadherin, EGF LAG seven-pass G-type receptor 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356824    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001408.2-8894s21c1
Sequence:CCGGTGCTCCTGTCTTGTGCTTTATCTCGAGATAAAGCACAAGACAGGAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001408.2-8790s21c1
Sequence:CCGGACTCGTCAGGCTCCGAATTTCCTCGAGGAAATTCGGAGCCTGACGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001408.2-5205s21c1
Sequence:CCGGCCATTCTGTCCTTCGATTATGCTCGAGCATAATCGAAGGACAGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001408.1-4724s1c1
Sequence:CCGGGCACATAGACATGGCTGACTTCTCGAGAAGTCAGCCATGTCTATGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001408.1-2207s1c1
Sequence:CCGGCCACTATACAGTGAATGTTAACTCGAGTTAACATTCACTGTATAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001408.1-7184s1c1
Sequence:CCGGGCCACTGAAGACACTGACATACTCGAGTATGTCAGTGTCTTCAGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011239    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001408.1-10182s1c1
Sequence:CCGGCCAAGCATGTATTCCAGACTTCTCGAGAAGTCTGGAATACATGCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001408.1-6579s1c1
Sequence:CCGGCGCTTGGACAAAGGGAACTTTCTCGAGAAAGTTCCCTTTGTCCAAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017392
CELSR2 MISSION shRNA Bacterial Glycerol Stock
cadherin, EGF LAG seven-pass G-type receptor 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017392.2-8729s1c1
Sequence:CCGGGCTCTGAATTTCTCTTCTTTACTCGAGTAAAGAAGAGAAATTCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017392.2-2941s1c1
Sequence:CCGGGCCCTGGTAGATTTGGACTATCTCGAGATAGTCCAAATCTACCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017392.2-2862s1c1
Sequence:CCGGCGCACAGATCATGTACCAGATCTCGAGATCTGGTACATGATCTGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017392.2-2863s1c1
Sequence:CCGGGCACAGATCATGTACCAGATTCTCGAGAATCTGGTACATGATCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017392.2-4678s1c1
Sequence:CCGGGCCGACTTCATTGCCAACAATCTCGAGATTGTTGGCAATGAAGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017392
CELSR2 MISSION shRNA shRNA Plasmid DNA
cadherin, EGF LAG seven-pass G-type receptor 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017392.2-8729s1c1
Sequence:CCGGGCTCTGAATTTCTCTTCTTTACTCGAGTAAAGAAGAGAAATTCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017392.2-2941s1c1
Sequence:CCGGGCCCTGGTAGATTTGGACTATCTCGAGATAGTCCAAATCTACCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017392.2-2862s1c1
Sequence:CCGGCGCACAGATCATGTACCAGATCTCGAGATCTGGTACATGATCTGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017392.2-2863s1c1
Sequence:CCGGGCACAGATCATGTACCAGATTCTCGAGAATCTGGTACATGATCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017392.2-4678s1c1
Sequence:CCGGGCCGACTTCATTGCCAACAATCTCGAGATTGTTGGCAATGAAGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017392
CELSR2 MISSION shRNA Lentiviral Transduction Particles
cadherin, EGF LAG seven-pass G-type receptor 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017392.2-8729s1c1
Sequence:CCGGGCTCTGAATTTCTCTTCTTTACTCGAGTAAAGAAGAGAAATTCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017392.2-2941s1c1
Sequence:CCGGGCCCTGGTAGATTTGGACTATCTCGAGATAGTCCAAATCTACCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017392.2-2862s1c1
Sequence:CCGGCGCACAGATCATGTACCAGATCTCGAGATCTGGTACATGATCTGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017392.2-2863s1c1
Sequence:CCGGGCACAGATCATGTACCAGATTCTCGAGAATCTGGTACATGATCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017392.2-4678s1c1
Sequence:CCGGGCCGACTTCATTGCCAACAATCTCGAGATTGTTGGCAATGAAGTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)